Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU150481

Sigma-Aldrich

MISSION® esiRNA

targeting human EIF4EBP1

Sign Into View Organizational & Contract Pricing

Select a Size


Select a Size

Change View

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGAGTGTCGGAACTCACCTGTGACCAAAACACCCCCAAGGGATCTGCCCACCATTCCGGGGGTCACCAGCCCTTCCAGTGATGAGCCCCCCATGGAAGCCAGCCAGAGCCACCTGCGCAATAGCCCAGAAGATAAGCGGGCGGGCGGTGAAGAGTCACAGTTTGAGATGGACATTTAAAGCACCAGCCATCGTGTGGAGCACTACCAAGGGGCCCCTCAGGGCCTTCCTGGGAGGAGTCCCACCAGCCAGGCCTTATGAAAGTGATCATACTGGGCAGGCGTTGGCGTGGGGTCGGACACCCCAGCCCTTTCTCCCTCACTCAGGGCACCTGCCCCCTCCTCTTCGTGAACACCAGCAGATACCTCCTTGTGCCTCCACTGATGCAGGAGCTGCCACCCCAAGGGGAGTGACCCCTGCCAGCACACCCTGCAGCCAAGGGCCAGGAAGTGGACAAGAACGAACCCTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Stabilization of 4E-BP1 by PI3K kinase and its involvement in CHK2 phosphorylation in the cellular response to radiation.
Zi-Jian Yu et al.
International journal of medical sciences, 14(5), 452-461 (2017-05-26)
Jin Young Sung et al.
Experimental gerontology, 109, 51-58 (2017-08-12)
Cellular senescence is related to aging and extremely stable proliferative arrest with active metabolism. Senescent cells can activate mammalian target of rapamycin (mTOR) pathway, which plays a crucial role in the regulation of cell metabolism, cellular growth, and autophagy in
Thomas Graillon et al.
Oncotarget, 8(33), 55361-55373 (2017-09-15)
Pasireotide is a somatostatin analog (SSA) that targets somatostatin receptor subtype 1 (SST1), SST2, SST3, and SST5 with a high affinity. Pasireotide has a better antisecretory effect in acromegaly, Cushing's disease, and neuroendocrine tumors than octreotide. In this study, we
Yuan-Chin Lee et al.
Cancer letters, 432, 191-204 (2018-06-19)
The present study aimed to investigate the pathway related to MCL1 expression in ABT-263-treated human leukemia U937 cells. ABT-263 upregulated MCL1 protein expression but did not affect its mRNA level and protein stability. Notably, ABT-263 increased 4EBP1 mRNA decay and thus
Lianhe Zheng et al.
Molecules and cells, 37(2), 118-125 (2014-03-07)
Osteosarcoma is the most common primary malignant bone tumor with a very poor prognosis. Treating osteosarcoma remains a challenge due to its high transitivity. Tenascin-C, with large molecular weight variants including different combinations of its alternative spliced FNIII repeats, is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service