Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU033441

Sigma-Aldrich

MISSION® esiRNA

targeting human XPC

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CGTTTCAATAAAGGGGTCCATGAGGACACACACAAGGTTCACCTTCTCTGCCTGCTAGCAAATGGCTTCTATCGAAATAACATCTGCAGCCAGCCAGATCTGCATGCTATTGGCCTGTCCATCATCCCAGCCCGCTTTACCAGAGTGCTGCCTCGAGATGTGGACACCTACTACCTCTCAAACCTGGTGAAGTGGTTCATTGGAACATTTACAGTTAATGCAGAACTTTCAGCCAGTGAACAAGATAACCTGCAGACTACATTGGAAAGGAGATTTGCTATTTACTCTGCTCGAGATGATGAGGAATTGGTCCATATATTCTTACTGATTCTCCGGGCTCTGCAGCTCTTGACCCGGCTGGTATTGTCTCTACAGCCAATTCCTCTGAAGTCAGCAACAGCAAAGGGAAAGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000154767

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... XPC(7508) , XPC(7508)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Timothy Budden et al.
BMC cancer, 18(1), 100-100 (2018-01-28)
Melanoma has two key features, an over-representation of UV-induced mutations and resistance to DNA damaging chemotherapy agents. Both of these features may result from dysfunction of the nucleotide excision repair pathway, in particular the DNA damage detection branch, global genome
Jyh-Cheng Chen et al.
Pharmacology, 102(1-2), 91-104 (2018-06-29)
Etoposide (VP16) is a topoisomerase II inhibitor and has been used for the treatment of non-small cell lung cancer (NSCLC). Xeroderma pigmentosum complementation group C (XPC) protein is a DNA damage recognition factor in nucleotide excision repair and involved in
Hiroyuki Niida et al.
Nature communications, 8, 16102-16102 (2017-07-19)
HBO1, a histone acetyl transferase, is a co-activator of DNA pre-replication complex formation. We recently reported that HBO1 is phosphorylated by ATM and/or ATR and binds to DDB2 after ultraviolet irradiation. Here, we show that phosphorylated HBO1 at cyclobutane pyrimidine
Jyh-Cheng Chen et al.
Toxicology research, 7(6), 1247-1256 (2018-12-18)
Astaxanthin has been demonstrated to exhibit a wide range of beneficial effects that include anti-cancer and anti-inflammatory properties. Xeroderma pigmentosum complementation group C (XPC) protein is an important DNA damage recognition factor in nucleotide excision repair and is involved in
Tiantian Cui et al.
Oncotarget, 6(12), 10060-10072 (2015-04-15)
Xeroderma pigmentosum complementation group C (XPC) protein is an important DNA damage recognition factor in nucleotide excision repair. Deletion of XPC is associated with early stages of human lung carcinogenesis, and reduced XPC mRNA levels predict poor patient outcome for

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej