Przejdź do zawartości
Merck

EHU008661

Sigma-Aldrich

MISSION® esiRNA

targeting human GADD45GIP1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTAAGCAGTTCGCGCGTTACGGCGCCGCCTCCGGGGTGGTCCCCGGTTCGTTATGGCCGTCGCCGGAGCAGCTGCGGGAGCTGGAGGCCGAAGAACGCGAATGGTACCCGAGCCTGGCGACCATGCAGGAGTCGCTGCGGGTGAAGCAGCTGGCCGAAGAGCAGAAGCGTCGGGAGAGGGAGCAGCACATCGCAGAGTGCATGGCCAAGATGCCACAGATGATTGTGAACTGGCAGCAGCAGCAGCGGGAGAACTGGGAGAAGGCCCAGGCTGACAAGGAGAGGAGGGCCCGACTGCAGGCTGAGGCCCAGGAGCTCCTGGGCTACCAGGTGGACCCAAGGAGTGCCCGCTTCCAGGAGCTGCTCCAGGACCTAGAGAAGAAGGAGCGCAAGCGCCTCAAGGAGGAAAAACAGAAACGGAAGAAGGAGGCGCGAGCTGCTGCATTGGCTGCAGCTGTGGCTCAAGACCCAGCAGCCTCTGGGGCACCCAGCTCCTGAGGCTTTGTCCCTTCCCAATAAAGCCTGCTACCTGGCA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Harsha Nagar et al.
Antioxidants & redox signaling, 27(4), 234-249 (2017-01-25)
Mitochondrial dysfunction has emerged as a major contributing factor to endothelial dysfunction and vascular disease, but the key mechanisms underlying mitochondrial dysfunction-induced endothelial dysfunction remain to be elucidated. In this study, we aim at determining whether mitochondrial dysfunction in endothelial
Runzhou Zhuang et al.
Oncotarget, 8(55), 94759-94768 (2017-12-08)
CR6-interacting factor 1 (CRIF1) regulates cell cycle progression and the DNA damage response. Here, we show that CRIF1 expression is decreased in hepatocellular carcinoma (HCC) tissues and positively correlates with patients' survival.
Min Joung Lee et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 40(7), 1546-1561 (2020-01-29)
Cerebral endothelial cells (ECs) require junctional proteins to maintain blood-brain barrier (BBB) integrity, restricting toxic substances and controlling peripheral immune cells with a higher concentration of mitochondria than ECs of peripheral capillaries. The mechanism underlying BBB disruption by defective mitochondrial
Shahrooz Vahedi et al.
Oncology reports, 34(1), 43-50 (2015-05-23)
Overexpression and hyperactivation of lymphocyte-specific protein tyrosine kinase (Lck) have been associated with leukemia development. We previously showed that, other than its known function as a cytoplasmic signal transducer, Lck also acts as a nuclear transcription factor in mouse leukemic
Harsha Nagar et al.
PloS one, 9(6), e98670-e98670 (2014-06-07)
Mitochondrial dysfunction has been implicated in the pathophysiology of various cardiovascular diseases. CRIF1 is a protein present in the mitochondria associated with large mitoribosomal subunits, and CRIF1 knockdown induces mitochondrial dysfunction and promotes ROS production. p66shc is a redox enzyme

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej