Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU047641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Brca1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGACTCCTTCCCAGGACAACTAGGTAGAAACAGAGGGCCTAAGGTGAACACTGTGCCTCCATTAGATAGTATGCAGCCTGGTGTCTGTCAGCAAAGTGTTCCTGTAAGTGATAAGTATCTTGAAATAAAAAAGCAGGAGGGTGAGGCTGTCTGTGCAGACTTCTCTCCATGTCTATTCTCAGACCATCTTGAGCAATCTATGAGTGGTAAGGTTTTTCAGGTTTGCTCTGAGACACCTGATGACCTGCTGGATGATGTTGAAATACAGGGACATACTAGCTTTGGTGAAGGTGACATAATGGAGAGATCTGCTGTCTTTAACGGAAGCATCCTGAGAAGGGAGTCCAGTAGGAGCCCTAGTCCTGTAACCCATGCATCGAAGTCTCAGAGTCTCCACAGAGCGTCTAGGAA

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Oreekha Amin et al.
BMC cancer, 15, 817-817 (2015-10-30)
Impairment of homologous recombination (HR) is found in close to 50 % of ovarian and breast cancer. Tumors with BRCA1 mutations show increased expression of the Insulin-like growth factor type 1 receptor (IGF-1R). We previously have shown that inhibition of
Nadire Duru et al.
Cancer letters, 369(1), 184-191 (2015-08-25)
Breast and lung cancer patients who are treated with radiotherapy often have severe side effects, including radiation-induced lung damage and secondary cancers. Activation of the NRF2 pathway is a well-known mechanism that protects cells against radiation induced oxidative stress, but
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for
Samir Acharya et al.
PloS one, 9(8), e103819-e103819 (2014-08-02)
Fifteen percent of tumors utilize recombination-based alternative lengthening of telomeres (ALT) to maintain telomeres. The mechanisms underlying ALT are unclear but involve several proteins involved in homologous recombination including the BLM helicase, mutated in Bloom's syndrome, and the BRCA1 tumor
Monique G P van der Wijst et al.
Molecular oncology, 9(7), 1259-1273 (2015-04-07)
Risk factors indicate the importance of oxidative stress during ovarian carcinogenesis. To tolerate oxidative stress, cells activate the transcription factor Nrf2 (Nfe2l2), the master regulator of antioxidant and cytoprotective genes. Indeed, for most cancers, hyperactivity of Nrf2 is observed, and

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej