Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU081751

Sigma-Aldrich

MISSION® esiRNA

targeting human DNM1L

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTTTTCACCCAACGTTGTCAATTTGACACTTGTGGATTTGCCAGGAATGACCAAGGTGCCTGTAGGTGATCAACCTAAGGATATTGAGCTTCAAATCAGAGAGCTCATTCTTCGGTTCATCAGTAATCCTAATTCCATTATCCTCGCTGTCACTGCTGCTAATACAGATATGGCAACATCAGAGGCACTTAAAATTTCAAGAGAGGTAGATCCAGATGGTCGCAGAACCCTAGCTGTAATCACTAAACTTGATCTCATGGATGCGGGTACTGATGCCATGGATGTATTGATGGGAAGGGTTATTCCAGTCAAACTTGGAATAATTGGAGTAGTTAACAGGAGCCAGCTAGATATTAACAACAAGAAGAGTGTAACTGATTCAATCCGTGATGAGTATGCTTTTCTTCAAAAGAAATATCCATCTCTGGCCAATAGAAA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000087470

numer dostępu NCBI

NM_005690

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... DNM1L(10059) , DNM1L(10059)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Unbin Chae et al.
Bioscience, biotechnology, and biochemistry, 83(3), 409-416 (2018-11-27)
Microglial activation is known to be an important event during innate immunity, but microglial inflammation is also thought to play a role in the etiology of neurodegenerative diseases. Recently, it was reported that autophagy could influence inflammation and activation of
Maria Manczak et al.
Human molecular genetics, 28(2), 177-199 (2018-09-22)
The purpose of our study was to better understand the effects of mitochondrial-division inhibitor 1 (Mdivi-1) on mitochondrial fission, mitochondrial biogenesis, electron transport activities and cellular protection. In recent years, researchers have found excessive mitochondrial fragmentation and reduced fusion in
S Xu et al.
Cell death & disease, 4, e540-e540 (2013-03-16)
Mitochondria are critical targets in the hepatotoxicity of cadmium (Cd). Abnormal mitochondrial dynamics have been increasingly implicated in mitochondrial dysfunction in pathophysiological conditions. Therefore, our study aimed to investigate the effects and underlying mechanism of Cd on mitochondrial dynamics during
Dongjoon Kim et al.
Cells, 9(7) (2020-07-16)
Diabetic retinopathy is a prevalent microvascular complication characterized by apoptotic vascular cell loss in the retina. Previous studies have shown that high glucose (HG)-induced mitochondrial fragmentation plays a critical role in promoting retinal vascular cell apoptosis. Here, we investigated whether
Chun Guo et al.
Scientific reports, 7, 43811-43811 (2017-03-07)
The GTPase dynamin-related protein 1 (Drp1) is essential for physiological and pathophysiological mitochondrial fission. DeSUMOylation of Drp1 by the enzyme SENP3 promotes cell death during reperfusion after ischaemia by enhancing Drp1 partitioning to the mitochondrial outer membrane (MOM), which causes
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej