Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU060821

Sigma-Aldrich

MISSION® esiRNA

targeting human PCSK9

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAGGCATTCAATCCTCAGGTCTCCACCAAGGAGGCAGGATTCTTCCCATGGATAGGGGAGGGGGCGGTAGGGGCTGCAGGGACAAACATCGTTGGGGGGTGAGTGTGAAAGGTGCTGATGGCCCTCATCTCCAGCTAACTGTGGAGAAGCCCCTGGGGGCTCCCTGATTAATGGAGGCTTAGCTTTCTGGATGGCATCTAGCCAGAGGCTGGAGACAGGTGCGCCCCTGGTGGTCACAGGCTGTGCCTTGGTTTCCTGAGCCACCTTTACTCTGCTCTATGCCAGGCTGTGCTAGCAACACCCAAAGGTGGCCTGCGGGGAGCCATCACCTAGGACTGACTCGGCAGTGTGCAGTGGTGCATGCACTGTCTCAGCCAACCCGCTCCACTACCCGGCAGGGTACACATTCGCACCCCTACTTCACAGAGGAAGAAACCTGGAACCAGAGGGGGCGTGCCTGCCAAGCTCACACAGCAGGAACTGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000169174

numer dostępu NCBI

NM_174936

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PCSK9(255738) , PCSK9(255738)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xiaohui Xu et al.
Experimental and therapeutic medicine, 13(5), 1993-1999 (2017-06-02)
Proprotein convertase subtilisin/kexin type 9 (PCSK9) is a member of the subtilisin family of PCs that encodes a neural apoptosis-regulated convertase 1. However, the precise role of PCSK9 in lung cancer cell apoptosis has remained elusive. In the present study
Yanting Zou et al.
Inflammation, 43(1), 251-263 (2019-11-30)
Lipopolysaccharide (LPS) is demonstrated to cause "two-hit" injury to liver. Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays an important role in LPS clearance. Hepatocyte nuclear factor-1 alpha (HNF-1α) and sterol regulatory element-binding protein 2 (SREBP2) were reported to be responsible
Ga Eun Lee et al.
Frontiers in endocrinology, 11, 607144-607144 (2021-01-26)
The proprotein convertase subtilisin/kexin type 9 (PCSK9) has been implicated in the pathogenesis of inflammatory diseases. We sought to investigate the role of PCSK9 in the pathogenesis of Graves' orbitopathy (GO) and whether it may be a legitimate target for
Dan Heo et al.
Nanotechnology, 26(33), 335101-335101 (2015-08-01)
The specific delivery of ribonucleic acid (RNA) interfering molecules to disease-related cells is still a critical blockade for in vivo systemic treatment. Here, this study suggests a robust delivery carrier for targeted delivery of RNA-interfering molecules using galactosylated magnetic nanovectors
Shirya Rashid et al.
Circulation, 130(5), 431-441 (2014-07-30)
Proprotein convertase subtilisin kexin type 9 (PCSK9) promotes the degradation of the low-density lipoprotein (LDL) receptor (LDLR), and its deficiency in humans results in low plasma LDL cholesterol and protection against coronary heart disease. Recent evidence indicates that PCSK9 also

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej