Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU030431

Sigma-Aldrich

MISSION® esiRNA

targeting human SNAI1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTTACCTTCCAGCAGCCCTACGACCAGGCCCACCTGCTGGCAGCCATCCCACCTCCGGAGATCCTCAACCCCACCGCCTCGCTGCCAATGCTCATCTGGGACTCTGTCCTGGCGCCCCAAGCCCAGCCAATTGCCTGGGCCTCCCTTCGGCTCCAGGAGAGTCCCAGGGTGGCAGAGCTGACCTCCCTGTCAGATGAGGACAGTGGGAAAGGCTCCCAGCCCCCCAGCCCACCCTCACCGGCTCCTTCGTCCTTCTCCTCTACTTCAGTCTCTTCCTTGGAGGCCGAGGCCTATGCTGCCTTCCCAGGCTTGGGCCAAGTGCCCAAGCAGCTGGCCCAGCTCTCTGAGGCCAAGGATCTCCAGGCTCGAAAGGCCTTCAACTGCAAATACTGCAACAAGGAATACCTCAGCCTGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000124216

numer dostępu NCBI

NM_005985

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... SNAI1(6615) , SNAI1(6615)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hong Li et al.
Theranostics, 9(7), 1909-1922 (2019-05-01)
Rationale: Glioblastoma (GBM) is the most common and aggressive brain tumor, characterized by its propensity to invade the surrounding brain parenchyma. The effect of extracellular high-mobility group box 1 (HMGB1) protein on glioblastoma (GBM) progression is still controversial. p62 is
Patrycja Przygodzka et al.
Scientific reports, 9(1), 2165-2165 (2019-02-17)
Epithelial-to-mesenchymal transition (EMT) in cancer cells, represents early stages of metastasis and is a promising target in colorectal cancer (CRC) therapy. There have been many attempts to identify markers and key pathways induced throughout EMT but the process is complex
Yun Zhan et al.
Oncotarget, 8(3), 4629-4641 (2016-11-29)
Metastasis is a multi-step process. Tumor cells occur epithelial-mesenchymal transition (EMT) to start metastasis, then, they need to undergo a reverse progression of EMT, mesenchymal-epithelial transition (MET), to colonize and form macrometastases at distant organs to complete the whole process
Binbin Zhang et al.
Oncology letters, 16(4), 5075-5083 (2018-09-27)
Human laryngeal squamous cell carcinoma (LSCC) is a malignant cancer type. Epithelial-mesenchymal transition marker Snail family transcriptional repressor 1 (SNAI1) is associated with the occurrence, development, invasion and metastasis of numerous tumor types, such as lung, liver and ovarian cancer.
Dong Yeon Kim et al.
Oncotarget, 8(63), 106190-106205 (2018-01-02)
Renal tubulointerstitial fibrosis is an important event in the pathogenesis of diabetic nephropathy. Under pathologic conditions, renal tubular epithelial cells undergo transition characterized by loss of cell-cell adhesion and increased cell migration. This study investigated that eucalyptol inhibited tubular epithelial
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej