Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

View All Documentation

EHU021751

Sigma-Aldrich

MISSION® esiRNA

targeting human ALKBH5

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTCAAGCCTATTCGGGTGTCGGAACCAGTGCTTTCCCTGCCGGTGCGCAGGGGAAGCGTGACTGTGCTCAGTGGATATGCTGCTGATGAAATCACTCACTGCATACGGCCTCAGGACATCAAGGAGCGCCGAGCAGTCATCATCCTCAGGAAGACAAGATTAGATGCACCCCGGTTGGAAACAAAGTCCCTGAGCAGCTCCGTGTTACCACCCAGCTATGCTTCAGATCGCCTGTCAGGAAACAACAGGGACCCTGCTCTGAAACCCAAGCGGTCCCACCGCAAGGCAGACCCTGATGCTGCCCACAGGCCACGGATCCTGGAGATGGACAAGGAAGAGAACCGGCGCTCGGTGCTGCTGCCCACACACCGGCGGAGGGGTAGCTTCAGCTCTGAGAACTACTGGCGCAAGTCATACGAGTCCTCAGAGGACTGCTCTGAGGCAGCAGGCAGCCCTGCCCGAAAGTCTACCCGCCGCCCTCCTGGGAACTCTGGCTC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000091542

numer dostępu NCBI

NM_017758

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... ALKBH5(54890) , ALKBH5(54890)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Zhiyuan Zhu et al.
Gene, 731, 144348-144348 (2020-01-14)
Mounting evidence demonstrates that N6-methyladenosine (m6A) play critical roles of m6A in the epigenetic regulation, especially for human cancer. The m6A modification is installed by methyltransferase and erased demethylases, leading to the significant modification for gene expression and cell fate.
Lianpin Wu et al.
BMC cancer, 19(1), 326-326 (2019-04-07)
Breast cancer (BC) displays striking genetic, epigenetic and phenotypic diversity. N6-methyladenosine (m6A) in mRNA has emerged as a crucial epitranscriptomic modification that controls cancer self-renewal and cell fate. However, the key enzymes of m6A expression and function in human breast
Chenyue Ding et al.
Journal of cellular physiology, 233(9), 7055-7066 (2018-02-01)
The N6-methyladenosine (m6A) modification plays a central role in epigenetic regulation of the mammalian transcriptome. m6A can be demethylated by the fat mass- and obesity-associated (FTO) protein and the α-ketoglutarate-dependent dioxygenase alkB homolog 5 (ALKBH5) protein. Much less is known
Omprakash Shriwas et al.
Apoptosis : an international journal on programmed cell death, 25(3-4), 233-246 (2020-01-25)
Platinum based drugs alone or in combination with 5FU and docetaxel are common regimen chemotherapeutics for the treatment of advanced OSCC. Chemoresistance is one of the major factors of treatment failure in OSCC. Human RNA helicase DDX3 plays an important
Rong Wu et al.
Cell research, 29(1), 23-41 (2018-12-06)
While N6-methyladenosine (m6A), the most abundant internal modification in eukaryotic mRNA, is linked to cell differentiation and tissue development, the biological significance of m6A modification in mammalian glial development remains unknown. Here, we identify a novel m6A reader, Prrc2a (Proline
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej