Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

Wyświetl całą dokumentację

EHU002651

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP1LC3B

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCCAAGTGAGCACATTCAGCTTTGGAAACTATATTATTTAATGTAGGCTAGCTTGTTTTCAAATTTTAAAAGTTTAAAAATAAAATACTTTGCATTCTAAGTTGCCAATAAAATAGACCTTCAAGTTATTTTAATGCTCTTTTCTCACTAATAGGAACTTGTAATTCCAGCAGTAATTTAAAGGCTTTCAGAGAGACCCTGAGTCTTCTCTTCAGGTTCACAAAACCCGCCGCCTTTTTGGGTAGAAGTTTTCTACTCAGCTAGAGAGATCTCCCTAAGAGGATCTTTAGGCCTGAGTTGTGAAGCGCAACCCCCGCAAAACGCATTTGCCATCACAGTTGGCACAAACGCAGGGTAAACGGGCTGTGTGAGAAAACGGCCCTGACTGTAAACTGCTGAAGGTCCCTGACTCCTAAGAGAACCACACCCAAAGTCCTCACT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000140941

numer dostępu NCBI

NM_022818

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MAP1LC3B(81631) , MAP1LC3B(81631)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
PSU
QCS
DLT
EGS
SGT

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Tamotsu Tsukahara et al.
BioMed research international, 2013, 204973-204973 (2013-11-30)
Our previous study demonstrated that PTB-associated splicing factor (PSF) is an important regulator of cell death and plays critical roles in the survival and growth of colon cancer cells. However, the molecular mechanism that activates these downstream signaling events remains
Alok Ranjan et al.
Scientific reports, 6, 26165-26165 (2016-05-18)
Pancreatic tumors exhibit enhanced autophagy as compared to any other cancer, making it resistant to chemotherapy. We evaluated the effect of penfluridol against pancreatic cancer. Penfluridol treatment induced apoptosis and inhibited the growth of Panc-1, BxPC-3 and AsPC-1, pancreatic cancer
Sheeja Aravindan et al.
Journal of biomedical science, 22, 28-28 (2015-04-22)
Identifying the drug-deliverables that target autophagy is crucial to finding a cure for pancreatic cancer (PC), as activated autophagy is associated with poor patient outcomes. Our recent studies recognized the anti-PC potential of an antioxidant-rich collection of seaweed polyphenols and
S Kumar et al.
Cell death & disease, 4, e889-e889 (2013-11-02)
Angiogenesis has a key role in the tumor progression and metastasis; targeting endothelial cell proliferation has emerged as a promising therapeutic strategy for the prevention of cancer. Previous studies have revealed a complex association between the process of angiogenesis and
Saroj Nepal et al.
Biomolecules & therapeutics, 22(5), 384-389 (2014-11-22)
Adiponectin, an adipokine predominantly secreted from adipose tissue, exhibits diverse biological responses, including metabolism of glucose and lipid, and apoptosis in cancer cells. Recently, adiponectin has been shown to modulate autophagy as well. While emerging evidence has demonstrated that autophagy
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej