Przejdź do zawartości
Merck

EHU001001

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF1A

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACCAAGTGCCACAAAGGAACCTACTTGTACAATGACTGTCCAGGCCCGGGGCAGGATACGGACTGCAGGGAGTGTGAGAGCGGCTCCTTCACCGCTTCAGAAAACCACCTCAGACACTGCCTCAGCTGCTCCAAATGCCGAAAGGAAATGGGTCAGGTGGAGATCTCTTCTTGCACAGTGGACCGGGACACCGTGTGTGGCTGCAGGAAGAACCAGTACCGGCATTATTGGAGTGAAAACCTTTTCCAGTGCTTCAATTGCAGCCTCTGCCTCAATGGGACCGTGCACCTCTCCTGCCAGGAGAAACAGAACACCGTGTGCACCTGCCATGCAGGTTTCTTTCTAAGAGAAAACGAGTGTGTCTCCTGTAGTAACTGTAAGAAAAGCCTGGAGTGCACGAAGTTGTGCCTACCCCAGATTGAGAATGTTAAGGGCACTGAGGACTCAGGCACCACAGTGCTGTTGCCCCTGGTCATTTTCTTTGGTCTTTGCCTTTTATCCCTCCTCTTCATTGGTTTAATGTATCGCTACCAACGGTGGAAGTCCAAGCTCTACTCCATTGTTTGTGGGAAATCGACA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hui Xu et al.
Toxicology letters, 280, 171-180 (2017-09-03)
Dysregulation of microRNAs (miRNAs) has been implicated in the pathogenesis of chronic obstructive pulmonary disease (COPD), which is largely attributable to cigarette smoke (CS). However, little is known about the effect of miRNAs on CS-induced mucus hypersecretion and the inflammatory
Yang Yu et al.
American journal of physiology. Heart and circulatory physiology, 313(4), H744-H756 (2017-07-16)
In systolic heart failure (HF), circulating proinflammatory cytokines upregulate inflammation and renin-angiotensin system (RAS) activity in cardiovascular regions of the brain, contributing to sympathetic excitation and cardiac dysfunction. Important among these is the subfornical organ (SFO), a forebrain circumventricular organ
Susana P Egusquiaguirre et al.
Neoplasia (New York, N.Y.), 20(5), 489-498 (2018-04-06)
The transcription factor STAT3 is activated inappropriately in 70% of breast cancers, most commonly in triple negative breast cancer (TNBC). Although the transcriptional function of STAT3 is essential for tumorigenesis, the key target genes regulated by STAT3 in driving tumor
Ruizhe Zhao et al.
Cell proliferation, 51(3), e12415-e12415 (2017-12-02)
Urinary tract infection, urinary frequency, urgency, urodynia and haemorrhage are common post-operative complications of thulium laser resection of the prostate (TmLRP). Our study mainly focuses on the role of finasteride in prostate wound healing through AR signalling. TmLRP beagles were
Xusheng Wang et al.
Nature communications, 8, 14091-14091 (2017-03-28)
Skin stem cells can regenerate epidermal appendages; however, hair follicles (HF) lost as a result of injury are barely regenerated. Here we show that macrophages in wounds activate HF stem cells, leading to telogen-anagen transition (TAT) around the wound and

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej