Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU011231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Il6

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCGGAGAGGAGACTTCACAGAGGATACCACTCCCAACAGACCTGTCTATACCACTTCACAAGTCGGAGGCTTAATTACACATGTTCTCTGGGAAATCGTGGAAATGAGAAAAGAGTTGTGCAATGGCAATTCTGATTGTATGAACAACGATGATGCACTTGCAGAAAACAATCTGAAACTTCCAGAGATACAAAGAAATGATGGATGCTACCAAACTGGATATAATCAGGAAATTTGCCTATTGAAAATTTCCTCTGGTCTTCTGGAGTACCATAGCTACCTGGAGTACATGAAGAACAACTTAAAAGATAACAAGAAAGACAAAGCCAGAGTCCTTCAGAGAGATACAGAAACTCTAATTCATATCTTCAACCAAGAGGTAAAAGATTTACATAAAATAGTCCTTCCTACCCCAATTTCC

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

12 - Non Combustible Liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yong Xia et al.
Molecular and cellular biochemistry, 398(1-2), 147-156 (2014-09-23)
Piperine, a kind of natural alkaloid found in peppers, has been reported to exhibit anti-oxidative and anti-tumor activities, both in vitro and in vivo. Interleukin-6 (IL-6) is an important cytokine that activates the signal transduction, promotes tumor cell metastasis, and
Victoria Ingham et al.
Journal of neuroinflammation, 11, 115-115 (2014-06-24)
Activated microglia are associated with deposits of aggregated proteins within the brains of patients with Alzheimer's disease (AD), Parkinson's disease (PD) and prion diseases. Since the cytokines secreted from activated microglia are thought to contribute to the pathogenesis of these
Shijia Zhang et al.
Stem cells (Dayton, Ohio), 32(6), 1616-1628 (2014-01-23)
Adipose-derived stromal/stem cells (ASCs) have anti-inflammatory as well as immunosuppressive activities and are currently the focus of clinical trials for a number of inflammatory diseases. Acute lung injury (ALI) is an inflammatory condition of the lung for which standard treatment

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica