Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU012051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tnf

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGTCCGGGCAGGTCTACTTTGGAGTCATTGCTCTGTGAAGGGAATGGGTGTTCATCCATTCTCTACCCAGCCCCCACTCTGACCCCTTTACTCTGACCCCTTTATTGTCTACTCCTCAGAGCCCCCAGTCTGTGTCCTTCTAACTTAGAAAGGGGATTATGGCTCAGAGTCCAACTCTGTGCTCAGAGCTTTCAACAACTACTCAGAAACACAAGATGCTGGGACAGTGACCTGGACTGTGGGCCTCTCATGCACCACCATCAAGGACTCAAATGGGCTTTCCGAATTCACTGGAGCCTCGAATGTCCATTCCTGAGTTCTGCAAAGGGAGAGTGGTCAGGTTGCCTCTGTCTCAGAATGAGGCTGGATAAGATCTCAGGCCTTCCTACCTTCAGACCTTTCCAGACTCTTCCCTGAGGTGC

Ensembl | Número de adesão de camundongo

ENSMUSG00000024401

nº de adesão NCBI

NM_013693

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... TNF(21926) , Tnf(21926)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Valentina Pileczki et al.
International journal of molecular sciences, 14(1), 411-420 (2012-12-25)
Tumor necrosis factor alpha (TNF-α) is a pro-inflammatory cytokine involved in the promotion and progression of cancer, including triple negative breast cancer cells. Thus, there is significant interest in understanding the molecular signaling pathways that connect TNF-α with the survival
Hank Cheng et al.
Journal of neuroinflammation, 13, 19-19 (2016-01-27)
The basis for air pollution-associated neurodegenerative changes in humans is being studied in rodent models. We and others find that the ultrafine particulate matter (PM) derived from vehicular exhaust can induce synaptic dysfunction and inflammatory responses in vivo and in
Li Peng et al.
The International journal of artificial organs, 38(10), 565-571 (2015-11-07)
Periprosthetic osteolysis, involving RANK/RANKL/osteoprotegerin (OPG) and TNF-α/NFκB signaling, contributes to bone resorption and inflammation. We constructed lentivirus vectors to inhibit TNF-α and enhance OPG expression and assessed their impacts on wear debris-induced inflammation and osteoclastogenesis in an osteoclast/osteoblast coculture system.
Wenwen Zheng et al.
Molecular pain, 7, 40-40 (2011-05-24)
HIV-associated sensory neuropathy (HIV-SN) is one of the most common forms of peripheral neuropathy, affecting about 30% of people with acquired immune deficiency syndrome (AIDS). The symptoms of HIV-SN are dominated by neuropathic pain. Glia activation in the spinal cord
Praveen Thumbikat et al.
PLoS pathogens, 5(5), e1000415-e1000415 (2009-05-05)
Urinary tract infections are the second most common infectious disease in humans and are predominantly caused by uropathogenic E. coli (UPEC). A majority of UPEC isolates express the type 1 pilus adhesin, FimH, and cell culture and murine studies demonstrate
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica