Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU095251

Sigma-Aldrich

MISSION® esiRNA

targeting human MUC1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGTTCAGGCCAGGATCTGTGGTGGTACAATTGACTCTGGCCTTCCGAGAAGGTACCATCAATGTCCACGACGTGGAGACACAGTTCAATCAGTATAAAACGGAAGCAGCCTCTCGATATAACCTGACGATCTCAGACGTCAGCGTGAGTGATGTGCCATTTCCTTTCTCTGCCCAGTCTGGGGCTGGGGTGCCAGGCTGGGGCATCGCGCTGCTGGTGCTGGTCTGTGTTCTGGTTGCGCTGGCCATTGTCTATCTCATTGCCTTGGCTGTCTGTCAGTGCCGCCGAAAGAACTACGGGCAGCTG

Ensembl | Número de adesão de ser humano

ENSG00000185499

nº de adesão NCBI

NM_001044392

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MUC1(4582) , MUC1(4582)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Satomi Shiba et al.
The Journal of surgical research, 238, 79-89 (2019-02-15)
Mucin1 (MUC1), a member of the mucin family, is a glycoprotein which is often expressed in malignant cells. However, the expression and function of MUC1 in human duodenal adenocarcinoma (DAC) has not yet been characterized because of its low frequency.
Ping Li et al.
International journal of clinical and experimental pathology, 8(9), 10365-10374 (2015-12-01)
Muc-1 is a member of the carbohydrate-binding protein family that contributes to neoplastic transformation, tumor survival, angiogenesis, and metastasis. The aim of this study is to investigate the role of muc-1 in human oral squamous cell carcinoma progression. In this
Dina Stroopinsky et al.
Journal of cellular and molecular medicine (2018-05-16)
Acute myeloid leukaemia (AML) is an aggressive haematological malignancy with an unmet need for improved therapies. Responses to standard cytotoxic therapy in AML are often transient because of the emergence of chemotherapy-resistant disease. The MUC1-C oncoprotein governs critical pathways of
Ashujit Tagde et al.
Oncotarget, 8(41), 69237-69249 (2017-10-21)
The polycomb repressive complex 1 (PRC1) includes the BMI1, RING1 and RING2 proteins. BMI1 is required for survival of multiple myeloma (MM) cells. The MUC1-C oncoprotein is aberrantly expressed by MM cells, activates MYC and is also necessary for MM
Yu-Ming Wang et al.
Drug design, development and therapy, 13, 3391-3404 (2019-10-03)
It has been reported that approximately 40% of ALI (acute lung injury) incidence resulted from sepsis. Paclitaxel, as a classic anti-cancer drug, plays an important role in the regulation of inflammation. However, we do not know whether it has a
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica