Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU062491

Sigma-Aldrich

MISSION® esiRNA

targeting human FYN

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGCAGATCATGAAGAAGCTGAAGCACGACAAGCTGGTCCAGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATCGTCACCGAGTATATGAACAAAGGAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGAGCTCTGAAATTACCAAATCTTGTGGACATGGCAGCACAGGTGGCTGCAGGAATGGCTTACATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCAGCAAACATTCTAGTGGGGAATGGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGATTGATAGAAGACAATGAGTACACAGCAAGACAAGGTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTACGGGAGGTTCACAATCAAGTCTGACGTGTGGTCTTTTGGAA

Ensembl | Número de adesão de ser humano

ENSG00000010810

nº de adesão NCBI

NM_153048

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FYN(2534) , FYN(2534)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jing Zheng et al.
Cancer biotherapy & radiopharmaceuticals, 32(9), 320-326 (2017-11-16)
Tyrosine kinase FYN-a member of the SRC family of kinases-is associated with mediating mitogenic signals and regulating cell cycle entry, growth, and proliferation. It was hypothesized that FYN is upregulated in thyroid carcinoma, which plays a critical role in tumorigenesis.
Michaela Nelson et al.
International journal of cancer, 135(10), 2338-2351 (2014-04-15)
Voltage-gated Na(+) channels (VGSCs) are heteromeric proteins composed of pore-forming α subunits and smaller β subunits. The β subunits are multifunctional channel modulators and are members of the immunoglobulin superfamily of cell adhesion molecules (CAMs). β1, encoded by SCN1B, is
Nikhil Panicker et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(27), 10058-10077 (2015-07-15)
Sustained neuroinflammation mediated by resident microglia is recognized as a key pathophysiological contributor to many neurodegenerative diseases, including Parkinson's disease (PD), but the key molecular signaling events regulating persistent microglial activation have yet to be clearly defined. In the present
Hadas Grossman et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 29(8), 3206-3216 (2015-04-30)
Granulosa cells support the developing oocytes and serve as transducers of the ovulatory stimulus induced by LH surge. Fyn kinase is expressed in granulosa cells, though its role in these cells has not been studied. In human embryonic kidney 293T

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica