Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU081381

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lrp5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTCACGGGTGTCAAAGAGGCCTCTGCACTGGACTTTGATGTGTCCAACAATCACATCTACTGGACTGATGTTAGCCTCAAGACGATCAGCCGAGCCTTCATGAATGGGAGCTCAGTGGAGCACGTGATTGAGTTTGGCCTCGACTACCCTGAAGGAATGGCTGTGGACTGGATGGGCAAGAACCTCTATTGGGCGGACACAGGGACCAACAGGATTGAGGTGGCCCGGCTGGATGGGCAGTTCCGGCAGGTGCTTGTGTGGAGAGACCTTGACAACCCCAGGTCTCTGGCTCTGGATCCTACTAAAGGCTACATCTACTGGACTGAGTGGGGTGGCAAGCCAAGGATTGTGCGGGCCTTCATGGATGGGACCAATTGTATGACACTGGTAGACAAGGTGGGCCGGGCCAACGACCTCACCATTGATTATGCCGACCAGCGACTGTACTGGACTGACCTGGACACCAACATG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nellie Y Loh et al.
Cell metabolism, 21(2), 262-273 (2015-02-05)
Common variants in WNT pathway genes have been associated with bone mass and fat distribution, the latter predicting diabetes and cardiovascular disease risk. Rare mutations in the WNT co-receptors LRP5 and LRP6 are similarly associated with bone and cardiometabolic disorders.
Ioanna Papathanasiou et al.
Arthritis research & therapy, 14(2), R82-R82 (2012-04-20)
Events normally taking place in the terminal chondrocyte differentiation in the growth plate are also observed during osteoarthritis (OA) development, suggesting that molecules, such as Wnts and bone morphogenetic proteins (BMPs) regulating chondrocyte activity in the growth plate, may play
Jessica Svedlund et al.
Endocrine-related cancer, 21(2), 231-239 (2013-12-03)
Primary hyperparathyroidism (pHPT) resulting from parathyroid tumors is a common endocrine disorder with incompletely understood etiology. In renal failure, secondary hyperparathyroidism (sHPT) occurs with multiple tumor development as a result of calcium and vitamin D regulatory disturbance. The aim of
Luqi Zhang et al.
Neurochemistry international, 87, 13-21 (2015-05-12)
Emerging studies have suggested the involvement of dysregulated Wnt/β-catenin cascade in the etiology of Alzheimer's disease (AD). Recently, genetic variations in Wnt co-receptor low density lipoprotein receptor-related protein (LRP) 6 causing reduced Wnt signaling has been linked to late-onset AD.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service