Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EMU010641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Map2k1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCCAGCATCTGAGCCTTTAGGAAGCAGCAAAGAGGAATTCTCTGCCCAGTGGCATGCCATGTTGCTTTCAGGCCTCTCCCATGCTTGTCTATGTTCAGACGTGCATCTCATCTGTGACAAAGGATGAAGAACACAGCATGTGCCAAATTGTACTTGTGTCATTTTTAATATCATTGTCTTTATCACTATGGTTACTCCCCTAAGTGGATTGGCTTTGTGCTTGGGGCTATTTGTCTGTTCATCAAACACATGCCAGGCTGAACTACAGTGAAACCCTAGTGACCTGGGTGGTCGTTCTTACTGATGTTTGCACTGCTGTTCATCGTGACTCACTAGCTGGCTGCCTGTATTGTCAGGATTCTCGGACCTTGGTACTTCACTCTTGCTGGTGACCTCTCAGTCTGAGAGGGAGCCTTGTG

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Działania biochem./fizjol.

Map2k1 (dual specificity mitogen-activated protein kinase kinase 1) is a serine threonine kinase and is required for ERK (extracellular-signal-regulated kinase) activation. Activation of ERK is associated with production of IL-10 (interleukin 10) and IL-12. Absence of the Map2k1 gene results in embryonic lethality. Map2k1 is responsible for the stimulation of epidermal proliferation, regulating cell migration in fibroblasts. Deficiency of Map2k1 protein causes lupus-like syndrome.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jui-Tai Chen et al.
Toxicology, 339, 40-50 (2015-12-15)
Glutamate can activate NMDA receptor (NMDAR) and subsequently induces excitotoxic neuron loss. However, roles of NMDARs in the blood-brain barrier (BBB) are little known. This study used a mouse cerebrovascular endothelial cell (MCEC) model to evaluate the effects of NMDAR
Mohamad Bouhamdan et al.
Cellular signalling, 27(10), 2068-2076 (2015-07-26)
The mitogen activated protein kinases ERK1/2 play an important role in response to toll like receptor (TLR) activation and cytokine production, including IL-10 and IL-12. Here, we examined the role of MEK1 in ERK1/2 activation in response to TLR4 agonist
Elisa Zienert et al.
Cancer letters, 364(1), 17-24 (2015-04-29)
Numerous factors determine the current poor prognosis of pancreatic ductal adenocarcinoma (PDAC). One of the greatest challenges to overcome is treatment resistance. Among a large repertoire of intrinsic resistance mechanisms, integrin-mediated cell adhesion to extracellular matrix (ECM) has been identified
Li Ren Kong et al.
Molecular cancer therapeutics, 14(7), 1750-1760 (2015-05-06)
Genomic analyses of squamous cell carcinoma (SCC) have yet to yield significant strategies against pathway activation to improve treatment. Platinum-based chemotherapy remains the mainstay of treatment for SCC of different histotypes either as a single-agent or alongside other chemotherapeutic drugs

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej