Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EMU074451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mapk8

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCATCATGAGCAGAAGCAAACGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTAAAACGATACCAGAATTTAAAGCCTATAGGCTCAGGAGCTCAAGGAATAGTGTGTGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTCAGCCGGCCATTTCAGAATCAGACCCATGCTAAGCGCGCCTACCGAGAACTAGTTCTTATGAAGTGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGTTAGATCATGAAAGAATGTCCTACCTTCTCTATCAAATGCTGTGTGGAATCAAGCACCTTCACTCTGCTG

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

12 - Non Combustible Liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xu Qin et al.
Molecular carcinogenesis, 53(7), 526-536 (2013-01-30)
The c-Jun NH2 -terminal kinase (JNK) signal pathway has been implicated in the growth, cellular proliferation, and apoptosis in many kinds of carcinomas. However, the role of JNK in the development of esophageal squamous cell carcinomas (ESCCs) is unknown. To
Shantel Olivares et al.
PloS one, 9(7), e103828-e103828 (2014-08-01)
Endoplasmic reticulum (ER) stress is induced in many forms of chronic liver disease and may promote the development of hepatocellular carcinoma. The activator protein 1 (AP-1) complex is a transcription factor that promotes hepatic carcinogenesis in response to cellular stress.
Wen-Pin Cheng et al.
PloS one, 10(4), e0123235-e0123235 (2015-04-22)
The expression of TRB3 (tribbles 3), an apoptosis regulated gene, increases during endoplasmic reticulum (ER) stress. How mechanical stress affects the regulation of TRB3 in cardiomyocytes during apoptosis is not fully understood. An in vivo model of aorta-caval shunt in
Wen-Tsong Hsieh et al.
Journal of neuro-oncology, 118(2), 257-269 (2014-04-24)
Glioblastoma multiforme (GBM) is the most common and lethal type of primary brain tumor characterized by its rapid infiltration to surrounding tissues during the early stages. The fast spreading of GBM obscures the initiation of the tumor mass making the
S Goda et al.
International endodontic journal, 48(12), 1122-1128 (2014-11-14)
To investigate the effects of the c-Jun N-terminal kinase (JNK1/2) on the inflammation cytokine tumour necrosis factor-alpha (TNF-α)-enhanced production of matrix metalloproteinase-3 (MMP-3) in human dental pulp fibroblast-like cells (HPFs). HPFs were grown from pulp explants from healthy donors. Primary

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej