Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EMU010011

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tlr2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGACACTGGGGGTAACATCGCTTTTTCCCAATCTCACAAATTTACAAACCCTCAGGATAGGAAATGTAGAGACTTTCAGTGAGATAAGGAGAATAGATTTTGCTGGGCTGACTTCTCTCAATGAACTTGAAATTAAGGCATTAAGTCTCCGGAATTATCAGTCCCAAAGTCTAAAGTCGATCCGCGACATCCATCACCTGACTCTTCACTTAAGCGAGTCTGCTTTCCTGCTGGAGATTTTTGCAGATATTCTGAGTTCTGTGAGATATTTAGAACTAAGAGATACTAACTTGGCCAGGTTCCAGTTTTCACCACTGCCCGTAGATGAAGTCAGCTCACCGATGAAGAAGCTGGCATTCCGAGGCTCGGTTCTCACTGATGAAAGCTTTAACGAGCTCCTGAAGCTGTTGCGTTACA

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000027995

numer dostępu NCBI

NM_011905

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... TLR2(24088) , Tlr2(24088)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Seok-Seong Kang et al.
Cytokine, 75(1), 174-180 (2015-05-20)
Staphylococcus aureus can cause the intestinal inflammatory diseases. However, little is known about the molecular mechanism of S. aureus infection in the intestine. In the present study, we investigated whether S. aureus could stimulate human intestinal epithelial cells triggering inflammation.
Helge Haarmann et al.
Biochemical and biophysical research communications, 467(1), 46-52 (2015-09-30)
Bacterial colonisation with Moraxella catarrhalis may partly sustain chronic inflammation in the lower airways of patients with chronic obstructive pulmonary disease (COPD). In addition, this bacterium causes infectious exacerbations of COPD, which often necessitate treatment with antibiotics. Antimicrobial peptides are
Megumi Inomata et al.
PloS one, 13(8), e0202791-e0202791 (2018-08-29)
Porphyromonas gingivalis possesses various abilities to evade and disrupt host immune responses, by which it acts as an important periodontal pathogen. P. gingivalis produces outer membrane protein A (OmpA)-like proteins (OmpALPs), Pgm6 and Pgm7, as major O-linked glycoproteins, but their
Seung Heon Shin et al.
Allergy, asthma & immunology research, 8(1), 63-68 (2015-11-06)
Chronic rhinosinusitis with nasal polyps is a chronic inflammatory disease with markedly increased eosinophils, Th2-type lymphocytes, fibroblasts, and goblet cells. Fungi are commonly associated with airway inflammatory diseases, and thymic stromal lymphopoietin (TSLP) is important in the development of Th2
Min Li et al.
Biochemical and biophysical research communications, 466(4), 748-754 (2015-10-02)
Microphage apoptosis is a critical event in atherosclerotic lesions in patients with diabetes. In the present investigation, high glucose treatment inhibited Akt phosphorylation and activated caspase 3 in primary peritoneal macrophage, leading to cell apoptosis. Hypoxia prolonged macrophage survival in
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej