Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU222801

Sigma-Aldrich

MISSION® esiRNA

targeting human IFITM3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GTCCCTGTTCAACACCCTCTTCATGAATGCTGCCTGGGCTTCATAGCATTCGCCTACTCCGTGAAGTCTAGGGACAGGAAGATGGTTGGCGACGTGACCGGGGCCCAGGCCCTCCACCGCCAAGTGCCTGAACATCTGGGCCCTGATTCTGGGCATCCTCATGACCATTCTGCTCATCGTCATCCCAGTGCTGATCTTCCAGGCCTATGGATAGATCAGGAGGCATCACTGAGGCCAGGAGCTCTGCCCATGACCTGTATCCCACGTACTCCAACTTCCATTCCTCG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000142089

numer dostępu NCBI

NM_021034

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... IFITM3(10410)

Opis ogólny

3355 esiRNA to siRNA przygotowane z użyciem endorybonukleazy. Stanowią one heterogeniczną mieszaninę siRNA, które celują w tę samą sekwencję mRNA. Te wielokrotne wyzwalacze wyciszania prowadzą do wysoce specyficznego i skutecznego wyciszania genów.

Aby uzyskać dodatkowe informacje, a także wyświetlić wszystkie dostępne opcje esiRNA, odwiedź SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumenty section.

Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Robert A Campbell et al.
Blood, 133(19), 2013-2026 (2019-02-07)
Evolving evidence indicates that platelets and megakaryocytes (MKs) have unexpected activities in inflammation and infection; whether viral infections upregulate biologically active, antiviral immune genes in platelets and MKs is unknown, however. We examined antiviral immune genes in these cells in
Yiming Liang et al.
Oncology reports, 40(6), 3261-3272 (2018-10-03)
The interferon-induced transmembrane protein 3 (IFITM3, also called 1‑8U) gene represents dysregulated expression in various tumors and is involved in tumorigenesis and progression. However, the role of IFITM3 and its underlying mechanism in hepatocellular carcinoma (HCC) are still far from elucidated.
Alexander Kühnl et al.
mBio, 9(4) (2018-07-26)
To transfer the viral genome into the host cell cytoplasm, internalized influenza A virus (IAV) particles depend on the fusion of the IAV envelope with host endosomal membranes. The antiviral host interferon (IFN) response includes the upregulation of interferon-induced transmembrane
Milene Mesquita et al.
PloS one, 9(6), e101056-e101056 (2014-07-01)
HIV-1-infected patients co-infected with A(H1N1)pdm09 surprisingly presented benign clinical outcome. The knowledge that HIV-1 changes the host homeostatic equilibrium, which may favor the patient resistance to some co-pathogens, prompted us to investigate whether HIV-1 infection could influence A(H1N1)pdm09 life cycle
Nicholas M Chesarino et al.
PLoS pathogens, 11(8), e1005095-e1005095 (2015-08-12)
Interferon (IFN)-induced transmembrane protein 3 (IFITM3) is a cell-intrinsic factor that limits influenza virus infections. We previously showed that IFITM3 degradation is increased by its ubiquitination, though the ubiquitin ligase responsible for this modification remained elusive. Here, we demonstrate that

Global Trade Item Number

SKUGTIN
EHU222801-20UG4061828792795
EHU222801-50UG4061828740789

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej