Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU153841

Sigma-Aldrich

MISSION® esiRNA

targeting human NFKB1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCAGGGTATAGCTTCCCACACTATGGATTTCCTACTTATGGTGGGATTACTTTCCATCCTGGAACTACTAAATCTAATGCTGGGATGAAGCATGGAACCATGGACACTGAATCTAAAAAGGACCCTGAAGGTTGTGACAAAAGTGATGACAAAAACACTGTAAACCTCTTTGGGAAAGTTATTGAAACCACAGAGCAAGATCAGGAGCCCAGCGAGGCCACCGTTGGGAATGGTGAGGTCACTCTAACGTATGCAACAGGAACAAAAGAAGAGAGTGCTGGAGTTCAGGATAACCTCTTTCTAGAGAAGGCTATGCAGCTTGCAAAGAGGCATGCCAATGCCCTTTTCGACTACGCGGTGACAGGAGACGTGAAGATGCTGCTGGCCGTCCAGCGCCATCTCACTGCTGTGCAGGATGAGAATGGGGACAGTGTCTTACACTTAGCAATCATCCACCTTCATTCTCAACTTGTGAGGGATCTACTAGAAGTCACATCTGGTTTGATTTCTGATGACATTATCAACATGAGAAATGATCTGTACCAGACGCCC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jie Song et al.
Molecular carcinogenesis, 56(1), 36-48 (2016-02-10)
Inflammatory microenvironment created by immune cells is favorable for tumor metastasis. Epithelial-mesenchymal transition (EMT) is involved in the progression of cancer invasion and metastasis in inflammatory microenvironment. In this study, we sought to investigate the effects of Icariside II, a
Zhihong Yuan et al.
Scientific reports, 7, 42028-42028 (2017-02-10)
Triggering receptor expressed on myeloid cells-1(TREM-1) is a member of the superimmunoglobulin receptor family. We have previously shown that TREM-1 prolongs survival of macrophages treated with lipoolysaccharide through Egr2-Bcl2 signaling. Recent studies suggest a role for TREM-1 in viral immunity.
Jing Zhou et al.
BioMed research international, 2018, 1650456-1650456 (2018-11-08)
Intermittent hypoxia (IH) that resulted from obstructive sleep apnea (OSA) has been found to be a risk factor of coronary artery disease. IH and the receptor for advanced glycation end products (RAGE) expression are known to activate monocyte/macrophage and associated
Yunxia Guo et al.
Cytotechnology, 73(1), 115-126 (2021-01-29)
This study intended to investigate the role of NFKB1 in oxidative stress injury and insulin resistance in gestational hypertension (GH) mice. Following establishment of a GH mouse model by high-fat diet, NFKB1, miR-106a, and FLOT2 expression was detected in liver
Shayna E Thomas-Jardin et al.
The Prostate, 80(2), 133-145 (2019-11-16)
The androgen receptor (AR) nuclear transcription factor is a therapeutic target for prostate cancer (PCa). Unfortunately, patients can develop resistance to AR-targeted therapies and progress to lethal disease, underscoring the importance of understanding the molecular mechanisms that underlie treatment resistance.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej