Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU122721

Sigma-Aldrich

MISSION® esiRNA

targeting human HMGA1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCCAGCCAAACTGTCTTTGTCACCACGTGGGGCTCACTTTTCATCCTTCCCCAACTTCCCTAGTCCCCGTACTAGGTTGGACAGCCCCCTTCGGTTACAGGAAGGCAGGAGGGGTGAGTCCCCTACTCCCTCTTCACTGTGGCCACAGCCCCCTTGCCCTCCGCCTGGGATCTGAGTACATATTGTGGTGATGGAGATGCAGTCACTTATTGTCCAGGTGAGGCCCAAGAGCCCTGTGGCCGCCACCTGAGGTGGGCTGGGGCTGCTCCCCTAACCCTACTTTGCTTCCGCCACTCAGCCATTTCCCCCTCCTCAGATGGGGCACCAATAACAAGGAGCTCACCCTGCCCGCTCCCAACCCCCCTCCTGCTCCTCCCTGCCCCCCAAGGTTCTGGTTCCATTTTTCCTCTGTTCACAAACTACCTCTGGACAGTTGTGTTGTTTTTTGTTCAATGTTCCATTCTTCGACATCCGTCATTG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Dae Kyoung Kim et al.
Experimental & molecular medicine, 48, e255-e255 (2016-08-27)
Cancer stem cells are a subpopulation of cancer cells characterized by self-renewal ability, tumorigenesis and drug resistance. The aim of this study was to investigate the role of HMGA1, a chromatin remodeling factor abundantly expressed in many different cancers, in
Liqian Zhu et al.
Virus research, 238, 236-242 (2017-07-08)
Bovine herpesvirus 1 (BoHV-1) is an important pathogen of cattle that causes clinical symptoms in the upper respiratory tract and conjunctivitis. Like most alpha-herpesvirinae subfamily members, BoHV-1 establishes latency in sensory neurons. Stress consistently induces reactivation from latency, which is
Satish Sati et al.
Molecular cell, 78(3), 522-538 (2020-03-30)
To understand the role of the extensive senescence-associated 3D genome reorganization, we generated genome-wide chromatin interaction maps, epigenome, replication-timing, whole-genome bisulfite sequencing, and gene expression profiles from cells entering replicative senescence (RS) or upon oncogene-induced senescence (OIS). We identify senescence-associated heterochromatin

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej