Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU111091

Sigma-Aldrich

MISSION® esiRNA

targeting human XIAP

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCATGGCAGATTATGAAGCACGGATCTTTACTTTTGGGACATGGATATACTCAGTTAACAAGGAGCAGCTTGCAAGAGCTGGATTTTATGCTTTAGGTGAAGGTGATAAAGTAAAGTGCTTTCACTGTGGAGGAGGGCTAACTGATTGGAAGCCCAGTGAAGACCCTTGGGAACAACATGCTAAATGGTATCCAGGGTGCAAATATCTGTTAGAACAGAAGGGACAAGAATATATAAACAATATTCATTTAACTCATTCACTTGAGGAGTGTCTGGTAAGAACTACTGAGAAAACACCATCACTAACTAGAAGAATTGATGATACCATCTTCCAAAATCCTATGGTACAAGAAGCTATACGAATGGGGTTCAGTTTCAAGGACATTAAGAAAATAATGGAGGAAAAAATTCAGATATCTGGGAGCAACTATAAATCACTTGAGGTTCTGGTTGCA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000101966

numer dostępu NCBI

NM_001167

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... XIAP(331) , XIAP(331)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Ke Ren et al.
Pathology oncology research : POR, 25(1), 341-348 (2017-11-11)
To find the exact downstream effector of Pim-2 pathway in prostate cancer cells, and to determine the means by which it affects prostate cancer. XIAP, Pim-2 and p-eIF4B expressions were detected in PCA and BPH tissues. Then the Pim-2 and
Ying Hou et al.
Journal of cell science, 130(2), 502-511 (2016-12-09)
Regulation of cell death is crucial for the response of cancer cells to drug treatments that cause arrest in mitosis, and is likely to be important for protection against chromosome instability in normal cells. Prolonged mitotic arrest can result in
Morikazu Miyamoto et al.
Anticancer research, 38(1), 301-306 (2017-12-27)
To investigate whether XIAP down-regulation and autophagy inhibition sensitize ovarian clear cell cancer cells to cisplatin. The ovarian clear cancer cell line KK was used for in vitro analysis. Hydroxychloroquine (HCQ) and phenoxodiol (PXD) or embelin were used as autophagy
Xiaodi Li et al.
International journal of oncology, 51(1), 327-335 (2017-06-01)
MicroRNAs play a crucial role in gene expression regulation in various types of cancers. Previous studies show the expression level of miR‑146a‑5p is downregulated in epithelial ovarian cancer. Further investigations suggest this downregulation is responsible for apoptosis resistance in ovarian
Rachel Coyle et al.
International journal of oncology, 55(1), 191-202 (2019-05-23)
Malignant rhabdoid tumour (MRT) is a rare, aggressive paediatric neoplasm, primarily diagnosed in those below the age of three. MRTs most commonly arise in the central nervous system and kidneys. A poor prognosis accompanies the MRT diagnosis, with a reported
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej