Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU098591

Sigma-Aldrich

MISSION® esiRNA

targeting human LRRK2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTCACGAGCTTTCCACAACAGCTATGTGAAACTCTGAAGAGTTTGACACATTTGGACTTGCACAGTAATAAATTTACATCATTTCCTTCTTATTTGTTGAAAATGAGTTGTATTGCTAATCTTGATGTCTCTCGAAATGACATTGGACCCTCAGTGGTTTTAGATCCTACAGTGAAATGTCCAACTCTGAAACAGTTTAACCTGTCATATAACCAGCTGTCTTTTGTACCTGAGAACCTCACTGATGTGGTAGAGAAACTGGAGCAGCTCATTTTAGAAGGAAATAAAATATCAGGGATATGCTCCCCCTTGAGACTG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Ji-Hye Yoon et al.
Biochimica et biophysica acta, 1864(12), 2356-2368 (2017-09-11)
Leucine-rich repeat kinase 2 (LRRK2), a multi-domain protein, is a key causative factor in Parkinson's disease (PD). Identification of novel substrates and the molecular mechanisms underlying the effects of LRRK2 are essential for understanding the pathogenesis of PD. In this
Zhongcan Chen et al.
Human molecular genetics, 26(22), 4494-4505 (2017-10-04)
Pathogenic leucine-rich repeat kinase 2 (LRRK2) mutations are recognized as the most common cause of familial Parkinson's disease in certain populations. Recently, LRRK2 mutations were shown to be associated with a higher risk of hormone-related cancers. However, how LRRK2 itself
Xiaodong Ding et al.
Neurobiology of disease, 98, 122-136 (2016-11-29)
Dominantly inherited mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common causes of familial Parkinson's disease (PD) and LRRK2 polymorphisms are associated with increased risk for idiopathic PD. However, the molecular mechanisms by which these mutations cause PD
Alexia F Kalogeropulou et al.
The Biochemical journal, 477(22), 4397-4423 (2020-11-03)
Mutations that enhance LRRK2 protein kinase activity cause inherited Parkinson's disease. LRRK2 phosphorylates a group of Rab GTPase proteins, including Rab10 and Rab12, within the effector-binding switch-II motif. Previous work has indicated that the PARK16 locus, which harbors the gene
Fieke Wauters et al.
Autophagy, 16(2), 203-222 (2019-04-05)
Parkinson disease (PD) is a disabling, incurable disorder with increasing prevalence in the western world. In rare cases PD is caused by mutations in the genes for PINK1 (PTEN induced kinase 1) or PRKN (parkin RBR E3 ubiquitin protein ligase)

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej