Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU095251

Sigma-Aldrich

MISSION® esiRNA

targeting human MUC1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGTTCAGGCCAGGATCTGTGGTGGTACAATTGACTCTGGCCTTCCGAGAAGGTACCATCAATGTCCACGACGTGGAGACACAGTTCAATCAGTATAAAACGGAAGCAGCCTCTCGATATAACCTGACGATCTCAGACGTCAGCGTGAGTGATGTGCCATTTCCTTTCTCTGCCCAGTCTGGGGCTGGGGTGCCAGGCTGGGGCATCGCGCTGCTGGTGCTGGTCTGTGTTCTGGTTGCGCTGGCCATTGTCTATCTCATTGCCTTGGCTGTCTGTCAGTGCCGCCGAAAGAACTACGGGCAGCTG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000185499

numer dostępu NCBI

NM_001044392

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MUC1(4582) , MUC1(4582)

Powiązane kategorie

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Satomi Shiba et al.
The Journal of surgical research, 238, 79-89 (2019-02-15)
Mucin1 (MUC1), a member of the mucin family, is a glycoprotein which is often expressed in malignant cells. However, the expression and function of MUC1 in human duodenal adenocarcinoma (DAC) has not yet been characterized because of its low frequency.
Ping Li et al.
International journal of clinical and experimental pathology, 8(9), 10365-10374 (2015-12-01)
Muc-1 is a member of the carbohydrate-binding protein family that contributes to neoplastic transformation, tumor survival, angiogenesis, and metastasis. The aim of this study is to investigate the role of muc-1 in human oral squamous cell carcinoma progression. In this
Dina Stroopinsky et al.
Journal of cellular and molecular medicine (2018-05-16)
Acute myeloid leukaemia (AML) is an aggressive haematological malignancy with an unmet need for improved therapies. Responses to standard cytotoxic therapy in AML are often transient because of the emergence of chemotherapy-resistant disease. The MUC1-C oncoprotein governs critical pathways of
Ashujit Tagde et al.
Oncotarget, 8(41), 69237-69249 (2017-10-21)
The polycomb repressive complex 1 (PRC1) includes the BMI1, RING1 and RING2 proteins. BMI1 is required for survival of multiple myeloma (MM) cells. The MUC1-C oncoprotein is aberrantly expressed by MM cells, activates MYC and is also necessary for MM
Yu-Ming Wang et al.
Drug design, development and therapy, 13, 3391-3404 (2019-10-03)
It has been reported that approximately 40% of ALI (acute lung injury) incidence resulted from sepsis. Paclitaxel, as a classic anti-cancer drug, plays an important role in the regulation of inflammation. However, we do not know whether it has a
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej