Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU094591

Sigma-Aldrich

MISSION® esiRNA

targeting human MYB

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGGCAGTAGAGCTTGGACAGAAAGAAAAGAAACTTGGTGTTAGGTAATTGACTATGCACTAGTATTTCAGACTTTTTAATTTTATATATATATACATTTTTTTTCCTTCTGCAATACATTTGAAAACTTGTTTGGGAGACTCTGCATTTTTTATTGTGGTTTTTTTGTTATTGTTGGTTTATACAAGCATGCGTTGCACTTCTTTTTTGGGAGATGTGTGTTGTTGATGTTCTATGTTTTGTTTTGAGTGTAGCCTGACTGTTTTATAATTTGGGAGTTCTGCATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAGAACTGTTGCATGGATCCTGTGTT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000118513

numer dostępu NCBI

NM_005375

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MYB(4602) , MYB(4602)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xuefeng Li et al.
Nature microbiology, 1(10), 16132-16132 (2016-09-28)
MicroRNAs (miRNAs) play critical roles in various biological processes, including cell proliferation, development and host defence. However, the molecular mechanism for miRNAs in regulating bacterial-induced inflammation remains largely unclear. Here, we report that miR-301b augments pro-inflammatory response during pulmonary infection
Yue Wang et al.
Cancer letters, 385, 234-242 (2016-10-25)
The oncoprotein Yes-associated protein (YAP) in Hippo pathway plays crucial roles in the development of cancer. However, the mechanism of YAP regulation in cancer remains poorly understood. Here, we supposed that the oncoprotein hepatitis B X-interacting protein (HBXIP) might be
Tian Lan et al.
Cancer research, 79(13), 3220-3234 (2019-05-19)
Understanding the roles of noncoding RNAs (ncRNA) in tumorigenesis and metastasis would establish novel avenues to identify diagnostic and therapeutic targets. Here, we aimed to identify hepatocellular carcinoma (HCC)-specific ncRNA and to investigate their roles in hepatocarcinogenesis and metastasis. RNA-seq
Neil Rajan et al.
The Journal of pathology, 239(2), 197-205 (2016-03-13)
Cutaneous cylindroma is an adnexal tumour with apocrine differentiation. A predisposition to multiple cylindromas is seen in patients with Brooke-Spiegler syndrome, who carry germline mutations in the tumour suppressor gene CYLD. Previous studies of inherited cylindromas have highlighted the frequent
Sapana Jalnapurkar et al.
Stem cell research & therapy, 7(1), 171-171 (2016-11-24)
The success of hematopoietic stem cell (HSC) transplantation is dependent on the quality of the donor HSCs. Some sources of HSCs display reduced engraftment efficiency either because of inadequate number (e.g., fetal liver and cord blood), or age-related dysfunction (e.g.
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej