Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU078751

Sigma-Aldrich

MISSION® esiRNA

targeting human ERBB2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCATCTGCACCATTGATGTCTACATGATCATGGTCAAATGTTGGATGATTGACTCTGAATGTCGGCCAAGATTCCGGGAGTTGGTGTCTGAATTCTCCCGCATGGCCAGGGACCCCCAGCGCTTTGTGGTCATCCAGAATGAGGACTTGGGCCCAGCCAGTCCCTTGGACAGCACCTTCTACCGCTCACTGCTGGAGGACGATGACATGGGGGACCTGGTGGATGCTGAGGAGTATCTGGTACCCCAGCAGGGCTTCTTCTGTCCAGACCCTGCCCCGGGCGCTGGGGGCATGGTCCACCACAGGCACCGCAGCTCATCTACCAGGAGTGGCGGTGGGGACCTGACACTAGGGCTGGAGCCCTCTGAAGAGGAGGCCCCCAGGTCTCCACTGGCACCCTCCGAAGGGGCTGGCTCCGATGTATTTGATGGTGACCTGGGAAT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Tong Shu et al.
Cancer letters, 411, 65-73 (2017-10-11)
Resistance to platinum-based chemotherapy is a major cause of treatment failure in patients with epithelial ovarian cancer and predicts a poor prognosis. Previously, we found that HECTD3 confers cancer cell resistance to apoptosis. However, the significance of HECTD3 expression in
Yiseul Choi et al.
World journal of gastroenterology, 22(41), 9141-9153 (2016-11-30)
To investigated the relationships between HER2, c-Jun N-terminal kinase (JNK) and protein kinase B (AKT) with respect to metastatic potential of HER2-positive gastric cancer (GC) cells. Immunohistochemistry was performed on tissue array slides containing 423 human GC specimens. Using HER2-positve
Zhipeng Li et al.
British journal of cancer, 120(3), 306-316 (2018-12-27)
Epidermal growth factor receptor (EGFR) plays an important role in head and neck squamous cell carcinoma (HNSCC) proliferation and therapy resistance, but the efficacy of targeting of EGFR for therapy has been limited. Here, we explore the molecular link between
Nehal Gupta et al.
Scientific reports, 9(1), 5066-5066 (2019-03-27)
Paclitaxel is a first line chemotherapeutic agent for the patients with metastatic breast cancer. But inherited or acquired resistance to paclitaxel leads to poor response rates in a majority of these patients. To identify mechanisms of paclitaxel resistance, we developed
Tiia Honkanen et al.
International journal of oncology, 51(2), 599-606 (2017-06-29)
We have previously shown that cancer stem-like cells (CSLCs) can mediate therapy resistance in ALK translocated lung cancers. HER2 has been linked to CSLCs in breast cancers and, therefore, we wanted to assess whether HER2 has a role in CSLCs

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej