Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU075311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Egfr

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCCTGTGGGCCTGACTACTACGAAGTGGAAGAAGATGGCATCCGCAAGTGTAAAAAATGTGATGGGCCCTGTCGCAAAGTTTGTAATGGCATAGGCATTGGTGAATTTAAAGACACACTCTCCATAAATGCTACAAACATCAAACACTTCAAATACTGCACTGCCATCAGCGGGGACCTTCACATCCTGCCAGTGGCCTTTAAGGGGGATTCTTTCACGCGCACTCCTCCTCTAGACCCACGAGAACTAGAAATTCTAAAAACCGTAAAGGAAATAACAGGCTTTTTGCTGATTCAGGCTTGGCCTGATAACTGGACTGACCTCCATGCTTTCGAGAACCTAGAAATAATACGTGGCAGAACAAAGCAACATGGTCAGTTTTCTTTGGCGGTCGTTGGCCTGAACATCACATCACTGGGGCTGCGTTCCCTCAAGGAGATCAG

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000020122

numer dostępu NCBI

NM_007912

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... EGFR(13649) , Egfr(13649)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Ijeoma Adaku Umelo et al.
Lung cancer (Amsterdam, Netherlands), 90(2), 167-174 (2015-09-08)
Lung cancer remains the leading cause of cancer-related mortality worldwide, with metastatic disease frequently a prominent feature at the time of diagnosis. The role of NSCLC-derived EGFR mutations in cancer cell proliferation and survival has been widely reported, but little
Began Gopalan et al.
Biomaterials, 35(26), 7479-7487 (2014-06-11)
Hepatocellular carcinoma (HCC) is one of the most commonly diagnosed lethal cancers in the world. We previously showed two imidazolium salts (IBN-1 and IBN-9) with a moderate efficacy for HCC. Here we report a more potent imidazolium compound IBN-65 (1-benzyl-2-phenyl-3-(4-isopropyl)-benzyl-imidazolium
Yong Bian et al.
Biochemical and biophysical research communications, 463(4), 612-617 (2015-06-06)
Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates
Chuen-Mao Yang et al.
Journal of cellular physiology, 230(10), 2351-2361 (2015-04-30)
Carbon monoxide (CO), a reaction product of the cytoprotective heme oxygenase (HO)-1, displays an anti-inflammatory effect in various cellular injuries, but the precise mechanisms of HO-1 expression remain unknown. We used the transition metal carbonyl compound carbon monoxide-releasing molecule-2 (CORM-2)
Philippe Dje N'Guessan et al.
Biochemical and biophysical research communications, 450(2), 1038-1044 (2014-07-01)
Chronic lower airway inflammation is considered to be a major cause of pathogenesis and disease progression in chronic obstructive pulmonary disease (COPD). Moraxella catarrhalis is a COPD-associated pathogen causing exacerbations and bacterial colonization in the lower airways of patients, which
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej