Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU077321

Sigma-Aldrich

MISSION® esiRNA

targeting human PTK2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAATCCCACACATCTTGCTGACTTCACTCAAGTGCAAACCATTCAGTATTCAAACAGTGAAGACAAGGACAGAAAAGGAATGCTACAACTAAAAATAGCAGGTGCACCCGAGCCTCTGACAGTGACGGCACCATCCCTAACCATTGCGGAGAATATGGCTGACCTAATAGATGGGTACTGCCGGCTGGTGAATGGAACCTCGCAGTCATTTATCATCAGACCTCAGAAAGAAGGTGAACGGGCTTTGCCATCAATACCAAAGTTGGCCAACAGCGAAAAGCAAGGCATGCGGACACACGCCGTCTCTGTGTCAGAAACAGATGATTATGCTGAGATTATAGATGAAGAAGATACTTACACCATGCCCTCAACCAGGGATTATGAGATTCAAAGAGAAAGAATAGAACTTGGACGATGTATTGGAGAAGGCCAATTTGGAGATG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000169398

numer dostępu NCBI

NM_153831

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PTK2(5747) , PTK2(5747)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Irina M Shapiro et al.
Science translational medicine, 6(237), 237ra68-237ra68 (2014-05-23)
The goal of targeted therapy is to match a selective drug with a genetic lesion that predicts for drug sensitivity. In a diverse panel of cancer cell lines, we found that the cells most sensitive to focal adhesion kinase (FAK)
Juan Pablo Macagno et al.
PLoS genetics, 10(3), e1004262-e1004262 (2014-03-29)
Receptor Tyrosine Kinases (RTKs) and Focal Adhesion Kinase (FAK) regulate multiple signalling pathways, including mitogen-activated protein (MAP) kinase pathway. FAK interacts with several RTKs but little is known about how FAK regulates their downstream signalling. Here we investigated how FAK
Qi Cao et al.
Oncotarget, 7(47), 77468-77481 (2016-10-21)
To investigate the effects of microRNA-7 (miR-7) on the proliferation, migration and invasion of non-small cell lung cancer NSCLC) cells by targeting FAK through ERK/MAPK signaling pathway. NSCLC tissues and adjacent normal tissues were obtained from 160 NSCLC patients after
Frank Aboubakar Nana et al.
Molecular cancer therapeutics, 18(1), 17-27 (2018-10-26)
Small cell lung cancer (SCLC) has a poor prognosis. Focal adhesion kinase (FAK) is a non-receptor tyrosine kinase regulating cell proliferation, survival, migration, and invasion, which is overexpressed and/or activated in several cancers, including SCLC. We wanted to determine whether
Zhaokang Cheng et al.
The Journal of biological chemistry, 292(6), 2065-2079 (2016-12-21)
Autophagy is an evolutionarily conserved intracellular degradation/recycling system that is essential for cellular homeostasis but is dysregulated in a number of diseases, including myocardial hypertrophy. Although it is clear that limiting or accelerating autophagic flux can result in pathological cardiac
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej