Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU040501

Sigma-Aldrich

MISSION® esiRNA

targeting human UHRF1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGTGGACCATGGGAATTTTTTCACATACACGGGTAGTGGTGGTCGAGATCTTTCCGGCAACAAGAGGACCGCGGAACAGTCTTGTGATCAGAAACTCACCAACACCAACAGGGCGCTGGCTCTCAACTGCTTTGCTCCCATCAATGACCAAGAAGGGGCCGAGGCCAAGGACTGGCGGTCGGGGAAGCCGGTCAGGGTGGTGCGCAATGTCAAGGGTGGCAAGAATAGCAAGTACGCCCCCGCTGAGGGCAACCGCTACGATGGCATCTACAAGGTTGTGAAATACTGGCCCGAGAAGGGGAAGTCCGGGTTTCTCGTGTGGCGCTACCTTCTGCGGAGGGACGATGATGAGCCTGGCCCTTGGACGAAGGAGGGGAAGGACCGGATCAAGAAGCTGGGGCTGACCATGCAGTATCCAGAAGGCTACCTGGAAGCCCTGGCCAACCGAGAGCGAGAGAAGGAGAA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000034063

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... UHRF1(29128) , UHRF1(29128)

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Mahmoud Alhosin et al.
Technology in cancer research & treatment, 19, 1533033820947489-1533033820947489 (2020-09-12)
Thymoquinone (TQ), a natural anticancer agent exerts cytotoxic effects on several tumors by targeting multiple pathways, including apoptosis. Difluoromethylornithine (DFMO), an irreversible inhibitor of the ornithine decarboxylase (ODC) enzyme, has shown promising inhibitory activities in many cancers including leukemia by
Jieying Chen et al.
Journal of cellular and molecular medicine, 22(5), 2856-2864 (2018-03-09)
WD repeat protein 79 (WDR79) is a member of the WD-repeat protein family characterized by the presence of a series of WD-repeat domains and is a scaffold protein that participates in telomerase assembly, Cajal body formation and DNA double strand
Ting-Ting Ge et al.
Journal of ovarian research, 9(1), 42-42 (2016-07-20)
Up-regulation of UHRF1 has been observed in a variety of cancers and appears to serve as an independent prognostic factor. To explore the effect of UHRF1 gene silencing on apoptosis and proliferation of cervical squamous cell carcinoma (CSCC) CaSki cells.
Guangyan Kan et al.
Oncotarget, 8(24), 39497-39511 (2017-05-04)
UHRF1 (ubiquitin-like with PHD and RING finger domains 1) is a critical regulator for DNA methylation, and its frequent overexpression in human cancers has been associated with tumor-promoting effects. However, whether the overexpressed UHRF1 contributes to the establishment and maintenance
Feng Yan et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(11), 8887-8893 (2015-06-14)
Ubiquitin-like with PHD and ring finger domains 1 (UHRF1), known as ICB90 or Np95, has been found to be overexpressed in numerous cancers. In this study, we evaluated the expression level of UHRF1 in ovarian cancer. UHRF1 levels in paired
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej