Przejdź do zawartości
Merck

EHU015291

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPM7

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCCATCTACCGAAGACACTCATGAAGTAGATTCCAAAGCAGCTTTAATACCGGATTGGTTACAAGATAGACCATCAAACAGAGAAATGCCATCTGAAGAAGGAACATTAAATGGTCTCACTTCTCCATTTAAGCCAGCTATGGATACAAATTACTATTATTCAGCTGTGGAAAGAAATAACTTGATGAGGTTATCACAGAGCATTCCATTTACACCTGTGCCTCCAAGAGGGGAGCCTGTCACAGTGTATCGTTTGGAAGAGAGTTCACCCAACATACTAAATAACAGCATGTCTTCTTGGTCACAACTAGGCCTCTGTGCCAAAATAGAGTTTTTAAGCAAAGAGGAGATGGGAGGAGGTTTACGAAGAGCTGTCAAAGTACAGTGTACCTGGTCAGAACATGATATCCTCAAATCAGGGCATCTT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xiuzhi Zhang et al.
Acta biomaterialia, 63, 369-382 (2017-09-09)
Mg-based alloys, as the potential orthopaedic implant, can self-degrade to avoid second operation for its remove, and enable to promote bone repair; however, the underlying molecular mechanisms remain unclear. In the present study, we examined the effect of Mg ions
Constantin Römmelt et al.
Journal of biomedical materials research. Part B, Applied biomaterials, 107(6), 1806-1813 (2018-12-07)
The reasons for the high number of loosened metal-on-metal (MoM) hip implants are still not fully understood. Hypoxia-inducible factor 1 (HIF-1) mediated signaling pathways, which normally modulate tissue metabolism under hypoxic circumstances, could be triggered by metallic wear debris and
Yuqiang Liu et al.
Cell reports, 23(12), 3480-3491 (2018-06-21)
The TRPM7 chanzyme contributes to several biological and pathological processes in different tissues. However, its role in the CNS under physiological conditions remains unclear. Here, we show that TRPM7 knockdown in hippocampal neurons reduces structural synapse density. The synapse density
Aifen Liu et al.
Scientific reports, 8(1), 5510-5510 (2018-04-05)
Transient receptor potential melastatin 7 (TRPM7) is a membrane ion channel and kinase. TRPM7 was abundantly expressed in the kidney, and up-regulated by ischemia reperfusion (IR) injury. Our previous studies showed that cyclic helix B peptide (CHBP) improved renal IR-related
Hong-Liang Xu et al.
Neurochemistry international, 112, 197-205 (2017-07-25)
Neuronal death after traumatic brain injury (TBI) is a complex process resulting from a combination of factors, many of which are still unknown. Transient receptor potential melastatin 7 (TRPM7) is a transient receptor potential channel that has been demonstrated to

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej