Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU151821

Sigma-Aldrich

MISSION® esiRNA

targeting human PPARA

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCCCTCCTCGGTGACTTATCCTGTGGTCCCCGGCAGCGTGGACGAGTCTCCCAGTGGAGCATTGAACATCGAATGTAGAATCTGCGGGGACAAGGCCTCAGGCTATCATTACGGAGTCCACGCGTGTGAAGGCTGCAAGGGCTTCTTTCGGCGAACGATTCGACTCAAGCTGGTGTATGACAAGTGCGACCGCAGCTGCAAGATCCAGAAAAAGAACAGAAACAAATGCCAGTATTGTCGATTTCACAAGTGCCTTTCTGTCGGGATGTCACACAACGCGATTCGTTTTGGACGAATGCCAAGATCTGAGAAAGCAAAACTGAAAGCAGAAATTCTTACCTGTGAACATGACATAGAAGATTCTGAAACTGCAGATCTCAAATCTCTGGCCAAGAGAATCTACGAGGCC

N° accesso Ensembl | uomo

ENSG00000186951

N° accesso NCBI

NM_001001928

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PPARA(5465) , PPARA(5465)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

E Di Giacomo et al.
Cell cycle (Georgetown, Tex.), 16(1), 59-72 (2016-11-20)
PPARs are a class of ligand-activated transcription factors belonging to the superfamily of receptors for steroid and thyroid hormones, retinoids and vitamin D that control the expression of a large number of genes involved in lipid and carbohydrate metabolism and
Maja Grabacka et al.
Archives of dermatological research, 309(3), 141-157 (2017-01-14)
Recent studies revealed the cooperation between peroxisome proliferator-activated receptor gamma (PPARγ) and α-MSH signaling, which results in enhanced melanogenesis in melanocytes and melanoma cells. However, the agonists of PPARα, such as fenofibrate, exert depigmenting effect. Therefore, we aimed to check
Tânia Vieira Madureira et al.
Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology, 229, 1-9 (2018-12-12)
The crosstalk between peroxisome proliferator-activated receptor α (PPARα) and estrogenic pathways are shared from fish to humans. Salmonid fish had an additional genome duplication, and two PPARα isoforms (PPARαBa and PPARαBb) were previously identified. Since a negative regulation between estrogen
Hsu-Lung Jen et al.
Journal of atherosclerosis and thrombosis, 24(5), 508-517 (2016-09-16)
Previous studies demonstrated that endothelin-1 (ET-1) can significantly increase the cell size and stimulate adiponectin expression in cultured human cardiomyocytes (HCM). The aim of the present study was to investigate the effects of fenofibrate, a peroxisome proliferator-activated receptor-α (PPARα) activator
Sun Ah Ham et al.
Oncotarget, 8(55), 94091-94103 (2017-12-08)
Migration and invasion of cancer cells into surrounding tissue is a key stage of cancer metastasis. Here, we show that peroxisome proliferator-activated receptor (PPAR) δ regulates migration and invasion of human breast cancer cells via thrombospondin-1 (TSP-1) and its degrading
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.