Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU047641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Brca1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGACTCCTTCCCAGGACAACTAGGTAGAAACAGAGGGCCTAAGGTGAACACTGTGCCTCCATTAGATAGTATGCAGCCTGGTGTCTGTCAGCAAAGTGTTCCTGTAAGTGATAAGTATCTTGAAATAAAAAAGCAGGAGGGTGAGGCTGTCTGTGCAGACTTCTCTCCATGTCTATTCTCAGACCATCTTGAGCAATCTATGAGTGGTAAGGTTTTTCAGGTTTGCTCTGAGACACCTGATGACCTGCTGGATGATGTTGAAATACAGGGACATACTAGCTTTGGTGAAGGTGACATAATGGAGAGATCTGCTGTCTTTAACGGAAGCATCCTGAGAAGGGAGTCCAGTAGGAGCCCTAGTCCTGTAACCCATGCATCGAAGTCTCAGAGTCTCCACAGAGCGTCTAGGAA

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Ci dispiace, ma al momento non ci sono COA disponibili online per questo prodotto.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Oreekha Amin et al.
BMC cancer, 15, 817-817 (2015-10-30)
Impairment of homologous recombination (HR) is found in close to 50 % of ovarian and breast cancer. Tumors with BRCA1 mutations show increased expression of the Insulin-like growth factor type 1 receptor (IGF-1R). We previously have shown that inhibition of
Nadire Duru et al.
Cancer letters, 369(1), 184-191 (2015-08-25)
Breast and lung cancer patients who are treated with radiotherapy often have severe side effects, including radiation-induced lung damage and secondary cancers. Activation of the NRF2 pathway is a well-known mechanism that protects cells against radiation induced oxidative stress, but
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for
Samir Acharya et al.
PloS one, 9(8), e103819-e103819 (2014-08-02)
Fifteen percent of tumors utilize recombination-based alternative lengthening of telomeres (ALT) to maintain telomeres. The mechanisms underlying ALT are unclear but involve several proteins involved in homologous recombination including the BLM helicase, mutated in Bloom's syndrome, and the BRCA1 tumor
Monique G P van der Wijst et al.
Molecular oncology, 9(7), 1259-1273 (2015-04-07)
Risk factors indicate the importance of oxidative stress during ovarian carcinogenesis. To tolerate oxidative stress, cells activate the transcription factor Nrf2 (Nfe2l2), the master regulator of antioxidant and cytoprotective genes. Indeed, for most cancers, hyperactivity of Nrf2 is observed, and

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.