EHURLUC
MISSION® esiRNA
targeting RLUC
Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
About This Item
Codice UNSPSC:
41105324
NACRES:
NA.51
Prodotti consigliati
Descrizione
Powered by Eupheria Biotech
Livello qualitativo
Nome Commerciale
MISSION®
Forma fisica
lyophilized powder
Condizioni di spedizione
ambient
Temperatura di conservazione
−20°C
Descrizione generale
EHURLUC targets Renilla Luciferase. It can be used as a negative control in systems lacking Renilla Luciferase, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Altre note
esiRNA cDNA target sequence: GATAACTGGTCCGCAGTGGTGGGCCAGATGTAAACAAATGAATGTTCTTGATTCATTTATTAATTATTATGATTCAGAAAAACATGCAGAAAATGCTGTTATTTTTTTACATGGTAACGCGGCCTCTTCTTATTTATGGCGACATGTTGTGCCACATATTGAGCCAGTAGCGCGGTGTATTATACCAGACCTTATTGGTATGGGCAAATCAGGCAAATCTGGTAATGGTTCTTATAGGTTACTTGATCATTACAAATATCTTACTGCATGGTTTGAACTTCTTAATTTACCAAAGAAGATCATTTTTGTCGGCCATGATTGGGGTGCTTGTTTGGCATTTCATTATAGCTATGAGCATCAAGATAAGATCAAAGCAATAGTTCACGCTGAAAGTGTAGTAGATGTGATTGAATCATGGGATGAATGG
Note legali
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Codice della classe di stoccaggio
10 - Combustible liquids
Classe di pericolosità dell'acqua (WGK)
WGK 1
Punto d’infiammabilità (°F)
Not applicable
Punto d’infiammabilità (°C)
Not applicable
Certificati d'analisi (COA)
Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.
Possiedi già questo prodotto?
I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.
I clienti hanno visto anche
Rachel Elizabeth Miller et al.
Biochemical and biophysical research communications, 500(2), 391-397 (2018-04-15)
PPM1B is a metal-dependent serine/threonine protein phosphatase, with a similar structure and function to the well-known oncogene in breast cancer, PPM1D (WIP1). However, clinical significance of PPM1B as a pharmacological target in cancer therapy has not been explored. To test
6-Dehydrogingerdione restrains lipopolysaccharide-induced inflammatory responses in RAW 264.7 macrophages.
Huang SH, Lee CH, Wang HM, et al.
Journal of Agricultural and Food Chemistry, 62(37), 9171-9179 (2014)
Jonasz Jeremiasz Weber et al.
Neuropharmacology, 133, 94-106 (2018-01-23)
Deciphering the molecular pathology of Huntington disease is of particular importance, not only for a better understanding of this neurodegenerative disease, but also to identify potential therapeutic targets. The polyglutamine-expanded disease protein huntingtin was shown to undergo proteolysis, which results
Bram Piersma et al.
Cell and tissue research, 374(1), 165-175 (2018-05-05)
Mechanosensing of fibroblasts plays a key role in the development of fibrosis. So far, no effective treatments are available to treat this devastating disorder. Spectrins regulate cell morphology and are potential mechanosensors in a variety of non-erythroid cells, but little
Angela Russo et al.
Oncogene, 37(15), 1976-1990 (2018-01-26)
The signaling events involved in the onset of ovarian cancer from the fallopian tube epithelium (FTE) are crucial for early detection and treatment of the disease, but they remain poorly defined. Conditional homozygous knockout of PTEN mediated by PAX8-cre recombinase
Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..
Contatta l'Assistenza Tecnica.