Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU098701

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPT

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAGGTGACCTCCAAGTGTGGCTCATTAGGCAACATCCATCATAAACCAGGAGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGACTTCAAGGACAGAGTCCAGTCGAAGATTGGGTCCCTGGACAATATCACCCACGTCCCTGGCGGAGGAAATAAAAAGATTGAAACCCACAAGCTGACCTTCCGCGAGAACGCCAAAGCCAAGACAGACCACGGGGCGGAGATCGTGTACAAGTCGCCAGTGGTGTCTGGGGACACGTCTCCACGGCATCTCAGCAATGTCTCCTCCACCGGCAGCATCGACATGGTAGACTCGCC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Sheng Yi et al.
Journal of cell science, 132(6) (2019-02-21)
Tau protein (encoded by the gene microtubule-associated protein tau, Mapt) is essential for the assembly and stability of microtubule and the functional maintenance of the nervous system. Tau is highly abundant in neurons and is detectable in astrocytes and oligodendrocytes.
Tomi Rantamäki et al.
PloS one, 8(7), e68722-e68722 (2013-07-12)
Brain-derived neurotrophic factor (BDNF) importantly regulates learning and memory and supports the survival of injured neurons. Reduced BDNF levels have been detected in the brains of Alzheimer's disease (AD) patients but the exact role of BDNF in the pathophysiology of
Varun Balaji et al.
Autophagy, 14(12), 2139-2154 (2018-08-28)
Missorting of MAPT/Tau represents one of the early signs of neurodegeneration in Alzheimer disease. The triggers for this are still a matter of debate. Here we investigated the sorting mechanisms of endogenous MAPT in mature primary neurons using microfluidic chambers

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.