Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU019931

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF11

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCCCCGTAACAAGAGAGGAGTGATAATTAAAGGTTTAGAAGAAATTACAGTACACAACAAGGATGAAGTCTATCAAATTTTAGAAAAGGGGGCAGCAAAAAGGACAACTGCAGCTACTCTGATGAATGCATACTCTAGTCGTTCCCACTCAGTTTTCTCTGTTACAATACATATGAAAGAAACTACGATTGATGGAGAAGAGCTTGTTAAAATCGGAAAGTTGAACTTGGTTGATCTTGCAGGAAGTGAAAACATTGGCCGTTCTGGAGCTGTTGATAAGAGAGCTCGGGAAGCTGGAAATATAAATCAATCCCTGTTGACTTTGGGAAGGGTCATTACTGCCCTTGTAGAAAGAACACCTCATGTTCCTTATCGAGAATCTAAACTAACTAGAATCCTCCAGGATTCTCTTGGAGGGCGTACA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

I clienti hanno visto anche

Slide 1 of 4

1 of 4

Wei Zhang et al.
Advanced healthcare materials, 5(12), 1493-1504 (2016-04-26)
Developing RNA-interference-based therapeutic approaches with efficient and targeted cytosolic delivery of small interfering RNA (siRNA) is remaining a critical challenge since two decades. Herein, a multifunctional transferrin receptor (TfR)-targeted siRNA delivery system (Tf&INF7) is designed based on siRNA complexes formed
Kai Zhu et al.
American journal of translational research, 11(4), 2245-2256 (2019-05-21)
Micro RNA (miRNAs) is a kind of non coding small RNAs with negative regulation function, which plays an important role in regulating the occurrence and development of tumors. In this study, we analyzed the expression level and role of miRNA-186-5p
Takeharu Imai et al.
Anticancer research, 37(1), 47-55 (2016-12-25)
Oesophageal squamous cell carcinoma (ESCC) and colorectal cancer (CRC) are common types of human cancer. Spheroid colony formation is used to characterize cancer stem cell (CSCs). In the present study, we analyzed the significance of kinesin family 11 (KIF11 in
Myles Fennell et al.
Assay and drug development technologies, 13(7), 347-355 (2015-08-13)
Uptake of nutrients, such as glucose and amino acids, is critical to support cell growth and is typically mediated by cell surface transporters. An alternative mechanism for the bulk uptake of nutrients from the extracellular space is macropinocytosis, a nonclathrin
Tatsuya Kato et al.
Molecular cancer research : MCR, 16(1), 47-57 (2017-10-11)
Inhibiting specific gene expression with siRNA provides a new therapeutic strategy to tackle many diseases at the molecular level. Recent strategies called high-density lipoprotein (HDL)-mimicking peptide-phospholipid nanoscaffold (HPPS) nanoparticles have been used to induce siRNAs-targeted delivery to

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.