Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU133481

Sigma-Aldrich

MISSION® esiRNA

targeting human TMEM173

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GATATCTGCGGCTGATCCTGCCAGAGCTCCAGGCCCGGATTCGAACTTACAATCAGCATTACAACAACCTGCTACGGGGTGCAGTGAGCCAGCGGCTGTATATTCTCCTCCCATTGGACTGTGGGGTGCCTGATAACCTGAGTATGGCTGACCCCAACATTCGCTTCCTGGATAAACTGCCCCAGCAGACCGGTGACCATGCTGGCATCAAGGATCGGGTTTACAGCAACAGCATCTATGAGCTTCTGGAGAACGGGCAGCGGGCGGGCACCTGTGTCCTGGAGTACGCCACCCCCTTGCAGACTTTGTTTGCCATGTCACAATACAGTCAAGCTGGCTTTAGCCGGGAGGATAGGCTTGAGCAGGCCAAACTCTTCTGCCGGACACTTGAGGACATCCTGGCAGATGCCCCTGAGTCTCAGAACAACTGCCGCCTCATTGCCTACCAGGAACC

Ensembl | Número de adesão de ser humano

ENSG00000184584

nº de adesão NCBI

NM_198282

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TMEM173(340061) , TMEM173(340061)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ji-Ae Kim et al.
The Journal of investigative dermatology, 137(10), 2101-2109 (2017-06-26)
Varicella zoster virus (VZV) is a human-restricted α-herpesvirus that exhibits tropism for the skin. The VZV host receptors and downstream signaling pathways responsible for the antiviral innate immune response in the skin are not completely understood. Here, we show that
Jin-Shan Ran et al.
International journal of molecular sciences, 19(12) (2018-11-25)
Innate immunity is an essential line of defense against pathogen invasion which is gained at birth, and the mechanism involved is mainly to identify pathogen-associated molecular patterns through pattern recognition receptors. STING (stimulator of interferon genes) is a signal junction
So-Young Lee et al.
Frontiers in immunology, 10, 1735-1735 (2019-08-14)
Hepatitis B virus infection is a serious global health problem and causes life-threatening liver disease. In particular, genotype C shows high prevalence and severe liver disease compared with other genotypes. However, the underlying mechanisms regarding virological traits still remain unclear.
Li Zhou et al.
Cancer letters, 500, 163-171 (2020-12-06)
Although the combination of chemotherapy and immunotherapy is a hot topic in lung cancer, little is understood regarding the possible mechanisms behind their synergy. Moreover, safety is a major concern for clinicians while performing chemotherapy. Therefore, it is important to
Junxia Cui et al.
Fish & shellfish immunology, 68, 29-36 (2017-07-08)
In the innate immune responses in host protection, pattern recognition receptors are involve in a variety of sensing mechanisms to recognize and counter pathogen invasion. Recently, a resident endoplasmic reticulum adaptor, stimulator of interferon genes (STING) protein, also called MPYS
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica