Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU132521

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT5

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCATAGCCGAGTGTGAGACCCGGCTGGGCAAGCAGGGCCGGCGAGTCGTGGTCATCACCCAGAACATCGATGAGCTGCACCGCAAGGCTGGCACCAAGAACCTTCTGGAGATCCATGGTAGCTTATTTAAAACTCGATGTACCTCTTGTGGAGTTGTGGCTGAGAATTACAAGAGTCCAATTTGTCCAGCTTTATCAGGAAAAGGTGCTCCAGAACCTGGAACTCAAGATGCCAGCATCCCAGTTGAGAAACTTCCCCGGTGTGAAGAGGCAGGCTGCGGGGGCTTGCTGCGACCTCACGTCGTGTGGTTTGGAGAAAACCTGGATCCTGCCATTCTGGAGGAGGTTGACAGAGAGCTCGCCCACTGTGATTTATGTCTAGTGGTGGGCACTTCCTCTGTGGTGTACCCAGCAGCCATGTT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shan Dang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 106, 966-975 (2018-09-02)
Hepatocellular carcinoma(HCC) is one of the most common cancers in the world, with the characteristics of high morbidity and mortality. Though the levels of diagnosis and treatment of HCC have been largely improved recently, the prognosis of these patients remains
Yuping Yin et al.
Molecular cancer therapeutics, 18(8), 1439-1450 (2019-05-31)
DNA replication and repair proteins play an important role in cancer initiation and progression by affecting genomic instability. The DNA endonuclease Mus81 is a DNA structure-specific endonuclease, which has been implicated in DNA replication and repair. In this study, we
Ratana Lim et al.
Biology of reproduction, 95(5), 95-95 (2016-11-05)
Preterm birth remains the major cause of neonatal mortality and morbidity, mediated largely by an inflammatory process. The sirtuin (SIRT) family of cellular regulators has been implicated as key inhibitors of inflammation. We have previously reported a role for SIRT1

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica