Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU130111

Sigma-Aldrich

MISSION® esiRNA

targeting human CTCF

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AACAGCAGGAGGGTCTGCTATCAGAGGTTAATGCAGAGAAAGTGGTTGGTAATATGAAGCCTCCAAAGCCAACAAAAATTAAAAAGAAAGGTGTAAAGAAGACATTCCAGTGTGAGCTTTGCAGTTACACGTGTCCACGGCGTTCAAATTTGGATCGTCACATGAAAAGCCACACTGATGAGAGACCACACAAGTGCCATCTCTGTGGCAGGGCATTCAGAACAGTCACCCTCCTGAGGAATCACCTTAACACACACACAGGTACTCGTCCTCACAAGTGCCCAGACTGCGACATGGCCTTTGTGACCAGTGGAGAATTGGTTCGGCATCGTCGTTACAAACACACCCACGAGAAGCCATTCAAGTGTTCCATGTGCGATTACGCCAGTGTAGAAGTCAGCAAATTAAAACGTCACATTCGCTCTCATACTGGAGAGCGTCCGTTTCAGTGCAGTTTGTGCAGTTATGCCAGCAGGGACACATACAAGCTGAAAAGGCACATGA

Ensembl | Número de adesão de ser humano

ENSG00000102974

nº de adesão NCBI

NM_006565

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CTCF(10664) , CTCF(10664)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
JDV
BWU
GRU
HOU
BMU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhengfei Shan et al.
Journal of cellular and molecular medicine, 23(5), 3130-3139 (2019-03-16)
The present research focuses on the influence of CCCTC-binding factor (CTCF) on prostate cancer (PC) via the regulation of the FoxO signalling pathway. A bioinformatics analysis was conducted to screen out target genes for CTCF in LNCaP cells and to
Elisa Fiorito et al.
Nucleic acids research, 44(22), 10588-10602 (2016-09-18)
Enhancer regions and transcription start sites of estrogen-target regulated genes are connected by means of Estrogen Receptor long-range chromatin interactions. Yet, the complete molecular mechanisms controlling the transcriptional output of engaged enhancers and subsequent activation of coding genes remain elusive.
Tommy W Terooatea et al.
Nucleic acids research, 44(21), e159-e159 (2016-08-24)
Recently, a number of advances have been implemented into the core ChIP-seq (chromatin immunoprecipitation coupled with next-generation sequencing) methodology to streamline the process, reduce costs or improve data resolution. Several of these emerging ChIP-based methods perform additional chemical steps on
Nathan A Damaschke et al.
Clinical epigenetics, 12(1), 80-80 (2020-06-07)
The chromatin insulator CCCTC-binding factor (CTCF) displays tissue-specific DNA binding sites that regulate transcription and chromatin organization. Despite evidence linking CTCF to the protection of epigenetic states through barrier insulation, the impact of CTCF loss on genome-wide DNA methylation sites
Francisco Puerta Martínez et al.
Journal of virology, 88(13), 7389-7401 (2014-04-18)
Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica