Pular para o conteúdo
Merck
Todas as fotos(2)

Documentos Principais

EHU106441

Sigma-Aldrich

MISSION® esiRNA

targeting human PTEN

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(2)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCT

Ensembl | Número de adesão de ser humano

ENSG00000171862

nº de adesão NCBI

NM_000314

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PTEN(5728) , PTEN(5728)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
VYU
XXT
LVT
BST
EPT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lei Dou et al.
Frontiers in oncology, 11, 614035-614035 (2021-03-27)
microRNAs (miRNAs) are of great significance in cancer treatment, which may have a desirable result on the regulation of tumorigenesis, progression, recurrence, and chemo-resistance of ovarian cancer. However, the research on the further potential application of miR-4461 in ovarian cancer
Ke Wang et al.
Biochemical and biophysical research communications, 521(3), 652-659 (2019-11-05)
WW domain containing E3 Ub-protein ligase 2 (WWP2) plays an important role in tumor progression as an E3 ligase of PTEN. Here, we investigated the role of WWP2 in gastric cancer (GC). We found that WWP2 is overexpressed in GC
Bo Yuan et al.
OncoTargets and therapy, 13, 9147-9157 (2020-09-29)
Long non-coding RNA (lncRNA) cancer susceptibility candidate 9 (CASC9) has been reported to play a vital role in tumorigenesis. This study explored the biological role of CASC9 and its regulation mechanism in bladder cancer (BC). Gene expression was evaluated using
Zheng Jin et al.
OncoTargets and therapy, 13, 1073-1086 (2020-02-27)
Glioma is the most commonly diagnosed primary brain tumor. Dysregulation of long non-coding RNA (lncRNA) is associated with initiation and development of various cancer types including glioma. The relative expression of lncRNA was analyzed by real time-quantitative polymerase chain reaction
Guang-Tao Yu et al.
Oncotarget, 6(39), 42067-42080 (2015-11-18)
Myeloid-derived suppressor cells (MDSCs) and tumor associated macrophages (TAMs) play key roles in the tumor immune suppressive network and tumor progression. However, precise roles of programmed death-1 (PD-1) in immunological functions of MDSCs and TAMs in head and neck squamous
Exibir todos os documentos relacionados

Protocolos

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica