Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU076701

Sigma-Aldrich

MISSION® esiRNA

targeting human TAZ

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AACAAGTCGGCTGTGGAGATGCGGAAAGCCCTGACGGACTTCATTCAAGAGGAATTCCAGCATCTGAAGACTCAGGCAGAGCAGCTCCACAACCACCTCCAGCCTGGGAGATAGGCCTTGCTTGCTGCCTTCTGGATTCTTGGCCCGCACAGAGCTGGGGCTGAGGGATGGACTGATGCTTTTAGCTCAAACGTGGCTTTTAGACAGATTTGTTCATAGACCCTCTCAAGTGCCCTCTCCGAGCTGGTAGGCATTCCAGCTCCTCCGTGCTTCCTCAGTTACACAAAGGACCTCAGCTGCTTCTCCCACTTGGCCAAGCAGGGAGGAAGAAGCTTAGGCAGGGCTCTCTTTCCTTCTTGCCTTCAGATGTTCTCTCCCAGGGGCTGGCTTCAGGAGGGAGCATAGA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wenguang Chang et al.
Molecular nutrition & food research, 63(7), e1801322-e1801322 (2019-01-12)
High fat (HF)-diet-induced insulin resistance is a major contributor to the pathogenesis of cardiovascular diseases. However, the molecular mechanisms that regulate cardiac insulin signaling are not fully understood. The regulatory role of tafazzin in the hearts of HF-diet-fed mice is
Libo Yan et al.
Archives of biochemistry and biophysics, 562, 31-36 (2014-08-01)
The Hippo-YAP pathway is altered and implicated as an oncogenic signaling pathway in many human cancers. Hypoxia is an important microenvironmental factor that promotes tumorigenesis. However, the effects of hypoxia on the two most important Hippo-YAP effectors, YAP (Yes-associated protein)
M Shanzer et al.
Oncogene, 34(32), 4190-4198 (2014-11-05)
The polyomavirus middle T antigen (PyMT) is an oncogene that activates the non-receptor tyrosine kinase, c-Src, and physically interacts with Taz (WWTR1). Taz is a pro-oncogenic transcription coactivator of the Tead transcription factors. The Hippo tumor suppressor pathway activates the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica