Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU073641

Sigma-Aldrich

MISSION® esiRNA

targeting human ARNTL

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGGAGGGACTCCAGACATTCCTTCCAGTGGCCTACTATCAGGCCAGGCTCAGGAGAACCCAGGTTATCCATATTCTGATAGTTCTTCTATTCTTGGTGAGAACCCCCACATAGGTATAGACATGATTGACAACGACCAAGGATCAAGTAGTCCCAGTAATGATGAGGCAGCAATGGCTGTCATCATGAGCCTCTTGGAAGCAGATGCTGGACTGGGTGGCCCTGTTGACTTTAGTGACTTGCCATGGCCGCTGTAAACACTACATGTTGCTTTGGCAACAGCTATAGTATCAAAGTGCATTACTGGTGGAGTTTTACAGTCTGTGAAGCTTACTGGATAAGGAGAGAATAGCTTTTATGTACTGACTTCATAAAAGCCATCTCAGAGCCATTGATACAAGTCAATCTTACTATATGTAACTTCAGACAAAGTGGAACTAAGCCTGCTCCA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Whitney Sussman et al.
American journal of physiology. Cell physiology, 317(3), C492-C501 (2019-06-20)
The transcription factor aryl hydrocarbon receptor nuclear translocator-like protein-1 (BMAL1) is an essential regulator of the circadian clock, which controls the 24-h cycle of physiological processes such as nutrient absorption. To examine the role of BMAL1 in small intestinal glucose
Panshak P Dakup et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 3347-3358 (2020-01-11)
Radiation therapy (RT) is commonly used to treat solid tumors of the breast, lung, and esophagus; however, the heart is an unintentional target of ionizing radiation (IR). IR exposure to the heart results in chronic toxicities including heart failure. We
Silke Kiessling et al.
BMC biology, 15(1), 13-13 (2017-02-16)
Circadian clocks control cell cycle factors, and circadian disruption promotes cancer. To address whether enhancing circadian rhythmicity in tumor cells affects cell cycle progression and reduces proliferation, we compared growth and cell cycle events of B16 melanoma cells and tumors
Nikolai Genov et al.
Scientific reports, 9(1), 11062-11062 (2019-08-01)
The circadian clock regulates key cellular processes and its dysregulation is associated to several pathologies including cancer. Although the transcriptional regulation of gene expression by the clock machinery is well described, the role of the clock in the regulation of
Rukeia El-Athman et al.
PLoS biology, 15(12), e2002940-e2002940 (2017-12-08)
The mammalian circadian clock and the cell cycle are two major biological oscillators whose coupling influences cell fate decisions. In the present study, we use a model-driven experimental approach to investigate the interplay between clock and cell cycle components and

Global Trade Item Number

SKUGTIN
EHU073641-20UG4061831352931
EHU073641-50UG4061831372830

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica