Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU035531

Sigma-Aldrich

MISSION® esiRNA

targeting human UPF1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGACGCCTACCAGTACCAGAACATATTCGGGCCCCTGGTCAAGCTGGAGGCCGACTACGACAAGAAGCTGAAGGAGTCCCAGACTCAAGATAACATCACTGTCAGGTGGGACCTGGGCCTTAACAAGAAGAGAATCGCCTACTTCACTTTGCCCAAGACTGACTCTGACATGCGGCTCATGCAGGGGGATGAGATATGCCTGCGGTACAAAGGGGACCTTGCGCCCCTGTGGAAAGGGATCGGCCACGTCATCAAGGTCCCTGATAATTATGGCGATGAGATCGCCATTGAGCTGCGGAGCAGCGTGGGTGCACCTGTGGAGGTGACTCACAACTTCCAGGTGGATTTTGTGTGGAAGTCGACCTCCTTTGACAGGATGCAGAGCGCATTGAAAACGTTTGCCGTGGATGAGACCTCGGTGTCTGGCTACATCTACCACAAGCTGTTGGGCCACGAGGTGGAGGACGTAAT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Seo-Young Lee et al.
Oncogene, 38(10), 1597-1610 (2018-10-24)
The point mutation that substitutes lysine with arginine at position 120 of human p53 has been characterized as a missense mutation. The K120R mutation renders the p53 protein disabled for acetylation and, as a result, defective for apoptotic function, which
Nagakatsu Harada et al.
Journal of cellular biochemistry, 118(11), 3810-3824 (2017-04-07)
Nonsense-mediated mRNA decay (NMD) degrades mRNAs carrying a premature termination codon (PTC) in eukaryotes. Cellular stresses, including endoplasmic reticulum (ER) stress, inhibit NMD, and up-regulate PTC-containing mRNA (PTC-mRNA) levels in several cell lines. However, whether similar effects exist under in
Aparna Kishor et al.
Nucleic acids research, 48(13), 7468-7482 (2020-06-17)
Alternative polyadenylation (APA) produces transcript 3' untranslated regions (3'UTRs) with distinct sequences, lengths, stabilities and functions. We show here that APA products include a class of cryptic nonsense-mediated mRNA decay (NMD) substrates with extended 3'UTRs that gene- or transcript-level analyses
Xiaojun Wang et al.
Environmental toxicology, 35(9), 998-1006 (2020-05-14)
The roles of long noncoding RNA (lncRNA) MACC1-AS1 have been revealed in various tumors. This work aims to explore the roles of lncRNA MACC1-AS1 in the stemness of nonsmall cell lung cancer (NSCLC) cells and the underlying mechanism. We showed
Tereza Grymová et al.
Molecular immunology, 107, 91-96 (2019-01-28)
Mutations in the C1 inhibitor (C1INH) encoding gene, SERPING1, are associated with hereditary angioedema (HAE) which manifests as recurrent submucosal and subcutaneous edema episodes. The major C1INH function is the complement system inhibition, preventing its spontaneous activation. The presented study

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica