Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU017401

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP4

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGTGGGATGGAACAGGACAGGAGGTGGTAGTGGATACCAGTTTGGAGAGCCCAGCTGGCCTGGCCATTGATTGGGTCACCAACAAACTGTACTGGACAGATGCAGGTACAGACCGGATTGAAGTAGCCAACACAGATGGCAGCATGAGAACAGTACTCATCTGGGAGAACCTTGATCGTCCTCGGGACATCGTGGTGGAACCCATGGGCGGGTACATGTATTGGACTGACTGGGGTGCGAGCCCCAAGATTGAACGAGCTGGCATGGATGCCTCAGGCCGCCAAGTCATTATCTCTTCTAATCTGACCTGGCCTAATGGGTTAGCTATTGATTATGGGTCCCAGCGTCTATACTGGGCTGACGCCGGCATGAAGACAATTGAATTTGCTGGACTGGATGGCAGTAAGAGGAAGGTGCTGATTGGAA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Qian Zhang et al.
Theranostics, 10(2), 602-614 (2020-01-07)
The mineral dust-induced gene (mdig) is overexpressed in a number of human cancers, suggesting critical roles of this gene played on the pathogenesis of cancers. Unlike several other JmjC-domain containing proteins that exhibit histone demethylase activity, it remains enigmatic whether
Xiaofen Zhou et al.
Biochemical and biophysical research communications, 503(1), 257-263 (2018-06-11)
Dysregulation of cell proliferation and death is considered the foundation of the malignant biological characteristics of cancer. In this study, we conducted a comprehensive analysis of a massively parallel whole transcriptome resequencing of paired papillary thyroid cancer and normal thyroid
Kai Wu et al.
Scientific reports, 6, 36305-36305 (2016-11-12)
Several epidemiological studies suggested an increased incidence rate of multiple myeloma (MM) among first responders and other individuals who exposed to World Trade Center (WTC) dust. In this report, we provided evidence showing that WTC dust is potent in inducing

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica