Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU125211

Sigma-Aldrich

MISSION® esiRNA

targeting human SCARB1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGTGGGTGAGATCATGTGGGGCTACAAGGACCCCCTTGTGAATCTCATCAACAAGTACTTTCCAGGCATGTTCCCCTTCAAGGACAAGTTCGGATTATTTGCTGAGCTCAACAACTCCGACTCTGGGCTCTTCACGGTGTTCACGGGGGTCCAGAACATCAGCAGGATCCACCTCGTGGACAAGTGGAACGGGCTGAGCAAGGTTGACTTCTGGC

Ensembl | Número de adesão de ser humano

ENSG00000073060

nº de adesão NCBI

NM_001082959

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SCARB1(949) , SCARB1(949)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Vasily Sukhorukov et al.
Biochimica et biophysica acta. Molecular and cell biology of lipids, 1864(5), 643-653 (2019-01-15)
Human plasma lipoproteins are known to contain various glycan structures whose composition and functional importance are starting to be recognized. We assessed N-glycosylation of human plasma HDL and LDL and the role of their glycomes in cellular cholesterol metabolism. N-glycomic
Ilaria Crivellari et al.
Free radical biology & medicine, 102, 47-56 (2016-11-21)
For its critical location, the skin represents the major interface between the body and the environment, therefore is one of the major biological barriers against the outdoor environmental stressors. Among the several oxidative environmental stressors, cigarette smoke (CS) has been
Rene Raphemot et al.
Cell chemical biology, 26(9), 1253-1262 (2019-07-02)
Plasmodium parasites undergo an obligatory and asymptomatic developmental stage within the liver before infecting red blood cells to cause malaria. The hijacked host pathways critical to parasite infection during this hepatic phase remain poorly understood. Here, we implemented a forward
Zhou-Yi Wu et al.
European journal of pharmacology, 853, 111-120 (2019-03-25)
Farnesoid X receptor (FXR) agonists play important regulatory roles in bile acid, lipid and glucose metabolism in vitro and in vivo. Thus, FXR agonists exhibit potential therapeutic effects on metabolism-related diseases that are associated with extrahepatic manifestations induced by hepatitis
Shudi Tang et al.
Scientific reports, 9(1), 1350-1350 (2019-02-06)
Therapeutic interventions that increase plasma high density lipoprotein (HDL) and apolipoprotein (apo) A-I levels have been reported to reduce plasma glucose levels and attenuate insulin resistance. The present study asks if this is a direct effect of increased glucose uptake
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica