Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU011031

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR7

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGAAGTTGGCTTCTGCTCAAATGCCAGAACTTCTGTAGAAAGTTATGAACCCCAGGTCCTGGAACAATTACATTATTTCAGATATGATAAGTATGCAAGGAGTTGCAGATTCAAAAACAAAGAGGCTTCTTTCATGTCTGTTAATGAAAGCTGCTACAAGTATGGGCAGACCTTGGATCTAAGTAAAAATAGTATATTTTTTGTCAAGTCCTCTGATTTTCAGCATCTTTCTTTCCTCAAATGCCTGAATCTGTCAGGAAATCTCATTAGCCAAACTCTTAATGGCAGTGAATTCCAACCTTTAGCAGAGCTGAGATATTTGGACTTCTCCAACAACCGGCTTGATTTACTCCATTCAACAGCATTTGAAGAGCTTCACAAACTGGAAGTTCTGGATATAAGCAGTAATAGCCATTATTTTCAATCAGAAGGAATTACTCATATGCTAAACTTTACCAAGAACCTAAAGGTTCTGCAGAAACTGATGATGAACGACAATGACATCTCTTCCTCCACCAGCAG

Ensembl | Número de adesão de ser humano

ENSG00000196664

nº de adesão NCBI

NM_016562

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TLR7(51284) , TLR7(51284)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
FWU
QPS
PET
UFS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yayi Huang et al.
Revista da Associacao Medica Brasileira (1992), 65(8), 1067-1073 (2019-09-19)
Diabetes is a risk factor for acute kidney injury (AKI). However, its mechanism of pathogenesis has not been elucidated. The aim of the study was to investigate the role of inflammation and the toll-like receptor 7 (TLR7) in ischemic AKI
Zhen Luo et al.
PLoS pathogens, 15(11), e1008142-e1008142 (2019-11-16)
As a neurotropic virus, human Enterovirus 71 (EV71) infection causes hand-foot-and-mouth disease (HFMD) and may develop severe neurological disorders in infants. Toll-like receptor 7 (TLR7) acts as an innate immune receptor and is also a death receptor in the central
Yun-Ru Liao et al.
Biochemical and biophysical research communications, 493(2), 1136-1142 (2017-08-28)
Diabetic retinopathy (DR) is a major microvascular complication of diabetes, resulting in neuronal dysfunction, retinal vascular leakage, and apoptosis within the retina. Innate immunity plays an important role in the pathogenesis of type 2 diabetes (T2D) and related complications. The
Ryoichiro Nishibayashi et al.
PloS one, 10(6), e0129806-e0129806 (2015-06-18)
Interleukin-12 (IL-12) is an important cytokine for the immunomodulatory effects of lactic acid bacteria (LAB). Using murine immune cells, we previously reported that the RNA of Enterococcus faecalis EC-12, a LAB strain exerting probiotic-like beneficial effects, is the major IL-12-inducing

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica