Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU210841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse E2f3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGAGAGTGGCCATCAGTACCTCTCAGATGGTCTAAAGACCCCCAAGGGCAAAGGAAGAGCTGCACTACGGAGTCCCGATAGTCCAAAAACTCCAAAATCTCCCTCAGAAAAAACGCGGTATGATACGTCCCTCGGTCTGCTCACCAAGAAGTTCATTCAGCTCCTGAGCCAGTCTCCTGATGGGGTCCTGGATCTGAACAAGGCAGCAGAGGTGCTCAAGGTGCAGAAGAGGAGGATTTACGACATCACCAACGTGCTGGAAGGCATCCACCTCATTAAGAAGAAGTCTAAGAACAACGTCCAGTGGATGGGCTGCAGTCTGTCTGAGGATGGGGGCATGCTGGCCCAGTGTCAAGGCCTGTCCAAAGAAGTGACTGAGCTCAGTCAGGAAGAGAAGAAATTAGATGAGCTGATCCAAAGCTGTACCCTGGACCTCAAACTGTTAACCGAGGATTCAGAGAATCAAAGGTTAGCTTATGTTACA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Sorry, we don't have COAs for this product available online at this time.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dianzhong Geng et al.
International journal of gynecological cancer : official journal of the International Gynecological Cancer Society, 25(4), 707-713 (2015-02-13)
Previous studies confirmed that high-risk human papillomavirus (HR-HPV) infection is a risk factor of cervical cancer, and the infection was associated with significantly reduced miR-34a expression during carcinogenesis. However, the downstream targets of miR-34a and their roles are still not
Miyoung Lee et al.
Oncotarget, 6(35), 37316-37334 (2015-10-30)
The E2F transcriptional activators E2F1, E2F2 and E2F3a regulate many important cellular processes, including DNA replication, apoptosis and centrosome duplication. Previously, we demonstrated that silencing E2F1 or E2F3 suppresses centrosome amplification (CA) and chromosome instability (CIN) in Her2+ breast cancer
Su'e Chang et al.
Oncotarget, 6(10), 7675-7685 (2015-03-13)
VitaminD3 signaling is involved in inhibiting the development and progression of gastric cancer (GC), while the active vitamin D metabolite 1-alpha,25-dihydroxyvitamin D3 (1,25(OH)2D3)-mediated gene regulatory mechanisms in GC remain unclear. We found that miR-145 is induced by 1,25(OH)2D3 in a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service