Skip to Content
MilliporeSigma
All Photos(1)

Documents

EMU064061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mcl1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGTTTGTGGAGTTCTTCCACGTACAGGACCTAGAAGGCGGCATCAGAAATGTGCTGCTGGCTTTTGCGGGTGTTGCTGGAGTAGGGGCTGGTCTGGCATATCTAATAAGATAGCCTTGTGAGTGCAATAGGGGACTCTTAAAGCTCCAGCCACCAAACTACATGCATCTGTGAAAACATGTGTATTTATGAAGGTGGACTTGAAGCTGCCCAGGATTTTAACAGTCCAGTTCTACTGTAGCAACATAGCAAAAAGAAAGTGGCTACAGGATTGTGGCTAACAAGAATAAATACATGGGAAAAGTGCTCCCCCTGGAAGAGTCACTGTCTGAATGAAGCAAAGTTCCCTCTCAGCAAACACTGAGAGGCCATGGAGAAGGACTTCTAGAATGAATGAAAGGGGTGGA

Ensembl | mouse accession no.

ENSMUSG00000038612

NCBI accession no.

NM_008562

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... MCL1(17210) , Mcl1(17210)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Weiguo Zhang et al.
Molecular cancer therapeutics, 13(7), 1848-1859 (2014-04-18)
Aberrant activation of multiple signaling pathways is common in acute myelogenous leukemia (AML) cells, which can be linked to a poor prognosis for patients with this disease. Previous research with mTOR or MEK inhibitors revealed cytostatic, rather than cytotoxic, effects
Shahin Assefnia et al.
Oncotarget, 5(6), 1458-1474 (2014-04-01)
Cadherin-11 (CDH11), associated with epithelial to mesenchymal transformation in development, poor prognosis malignancies and cancer stem cells, is also a major therapeutic target in rheumatoid arthritis (RA). CDH11 expressing basal-like breast carcinomas and other CDH11 expressing malignancies exhibit poor prognosis.
Minttu Kansikas et al.
Human mutation, 35(9), 1123-1127 (2014-06-14)
Lynch syndrome (LS), the most common familial colon cancer, is associated with mismatch repair (MMR) malfunction. As mutation carriers inherit one normal and one defected MMR gene allele, cancer risk can be considered as limited amount of normal MMR gene
O Richmond et al.
Veterinary microbiology, 180(3-4), 223-229 (2015-10-09)
Porcine circovirus type 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV) continue to have a negative economic impact on global swine production operations. Host immune modulations that potentiate disease during PCV2 and/or PRRSV infections are important areas of
Yi Liu et al.
Journal of proteomics, 106, 99-112 (2014-04-29)
Chronic hepatitis B virus (HBV) infection is a major risk factor for hepatocellular carcinoma (HCC), the sixth most common cancer worldwide. To explore potential biomarkers for HCC, iTRAQ coupled with mass spectrometry was used to analyze proteins in plasma from
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service