All Photos(1)

EMU058151

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pcsk9

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACAGGACCAGTGGAGAAGCCACAGTAGCTGCTGCCATCTGCTGCCGGAGCCGGCCTTCAGCAAAGGCCTCCTGGGTTCAGTGACAGCCTCAGGCAGGGATGGTGCTTGAGGCTGGGTGCAGAGATATGCCTGCATGGCTCTCTTGTAGCCAAAGGTGGGGAGATTCTGCGTGGGAGAACTTGGTGTCTCACCCTGGGTACCCATTCCTGGTGTATGGAAGCACCTCCTTCACGGTCAGGGGGCCTGTGCTTGGCTTTCTGCCATCAGACATTAAGCTGTAGCTGGCTCTGGCCAGCTGCTCCAGTGTACCAGAACCTGAGGATGCTCGCTGCAAGGCCTCAGTTCTCAGGCCTTAGGGTGTATTTGTCTTTCAGGAAGATCATAATGGACAGAGATCCTTGGAGGTTCAAAGACCAAGTACCAGACTGGAAAATTGAGTCTGAAAGCCACAAGGACAGTCAACTCACAGCCAGCTCACATTGCAGACACCATTTTGGGCTCCCTGATTAAATGCAGATCAGTTCTGCACACCTCCAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis

Certificate of Origin

Shirya Rashid et al.
Circulation, 130(5), 431-441 (2014-07-30)
Proprotein convertase subtilisin kexin type 9 (PCSK9) promotes the degradation of the low-density lipoprotein (LDL) receptor (LDLR), and its deficiency in humans results in low plasma LDL cholesterol and protection against coronary heart disease. Recent evidence indicates that PCSK9 also
Dan Heo et al.
Nanotechnology, 26(33), 335101-335101 (2015-08-01)
The specific delivery of ribonucleic acid (RNA) interfering molecules to disease-related cells is still a critical blockade for in vivo systemic treatment. Here, this study suggests a robust delivery carrier for targeted delivery of RNA-interfering molecules using galactosylated magnetic nanovectors

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service