Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU006911

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lgals3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATCACAATCATGGGCACAGTGAAACCCAACGCAAACAGGATTGTTCTAGATTTCAGGAGAGGGAATGATGTTGCCTTCCACTTTAACCCCCGCTTCAATGAGAACAACAGGAGAGTCATTGTGTGTAACACGAAGCAGGACAATAACTGGGGAAAGGAAGAAAGACAGTCAGCCTTCCCCTTTGAGAGTGGCAAACCATTCAAAATACAAGTCCTGGTTGAAGCTGACCACTTCAAGGTTGCGGTCAACGATGCTCACCTACTGCAGTACAACCATCGGATGAAGAACCTCCGGGAAATCAGCCAACTGGGGATCAGTGGTGACATAACCCTCACCAGCGCTAACCACGCCATGATCTAAGCCAGAAGGGGCGGCACCGAAACCGGCCCTGTGTGCCTTAGGAGTGGGAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Rafael Yamashita Ikemori et al.
PloS one, 9(11), e111592-e111592 (2014-11-05)
Galectin-3 (gal-3) is a β-galactoside binding protein related to many tumoral aspects, e.g. angiogenesis, cell growth and motility and resistance to cell death. Evidence has shown its upregulation upon hypoxia, a common feature in solid tumors such as glioblastoma multiformes
Lili Qiao et al.
Molecular medicine reports, 13(1), 160-166 (2016-01-01)
Galectin-3 is a multifunctional β-galactoside‑binding lectin that is involved in multiple biological functions which are upregulated in malignancies, including cell growth, adhesion, proliferation, progression and metastasis, as well as apoptosis. A previous study has confirmed the roles of galecin-3 overexpression
Junxiu Liu et al.
Gynecological endocrinology : the official journal of the International Society of Gynecological Endocrinology, 30(6), 461-465 (2014-03-22)
Vascular endothelial growth factor C (VEGF-C) promotes cervical cancer metastasis, while the detailed mechanism remains obscure. Recent evidence shows that galectin-3 (Gal-3), a glycan binding protein, interacts with the VEGF receptors and reinforces their signal transduction. In this study, we
D Zhu et al.
Leukemia, 29(7), 1587-1599 (2015-02-14)
The pathogenesis of Chlamydophila psittaci-negative ocular adnexal extranodal marginal zone lymphomas (OAEMZLs) is poorly understood. OAEMZLs are monoclonal tumors expressing a biased repertoire of mutated surface immunoglobulins. Antigenic activation of the B-cell receptor (BCR) may have a role in the
Sonja Aits et al.
Autophagy, 11(8), 1408-1424 (2015-06-27)
Lysosomal membrane permeabilization (LMP) contributes to tissue involution, degenerative diseases, and cancer therapy. Its investigation has, however, been hindered by the lack of sensitive methods. Here, we characterize and validate the detection of galectin puncta at leaky lysosomes as a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service