Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU122711

Sigma-Aldrich

MISSION® esiRNA

targeting human ARHGEF12

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTGCAGCTGTTTCCAGAGCATTGAATTACTAAAATCTCGCCCGGCTCATTTGGCTGTTTTCTTACACCATGTAGTTTCACAATTTGACCCTGCGACTTTGCTCTGTTATCTCTATTCAGACCTGTATAAACATACCAATTCCAAAGAAACTCGTCGCATCTTCCTTGAGTTTCATCAGTTCTTTCTAGATCGATCAGCACACCTGAAAGTTTCTGTTCCTGATGAAATGTCTGCAGATCTAGAAAAGAGAAGACCTGAGCTCATTCCTGAGGATCTGCATCGCCACTATATCCAAACTATGCAAGAAAGAGTCCATCCAGAAGTTCAAAGGCACTTAGAAGATTTTCGGCAGAAACGTAGTATGGGACTGACCTTGGCTGAAAGCGAGCTGACTAAACTTGATGCAGAGCGAGACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Anil Prasad et al.
Scientific reports, 7, 40648-40648 (2017-01-18)
DC-SIGN is a dendritic cell surface structure which participates in binding and transmission of HIV-1. Here, for the first time we demonstrate that cocaine induces over expression of DC-SIGN and significantly enhances virus transfer from DCs to T-cells by increasing
Wei-Chiao Chiu et al.
International journal of nanomedicine, 7, 5929-5939 (2012-12-13)
Studies to explore angiotensin II (Ang II) and its downstream signaling pathways via Rho guanine nucleotide exchange factors (RhoGEFs) and RhoA signaling are crucial to understanding the mechanisms of smooth muscle contraction leading to hypertension. This study aimed to investigate
Katsuhiko Hata et al.
The Journal of cell biology, 184(5), 737-750 (2009-03-11)
Neuronal axons are guided by attractive and repulsive cues in their local environment. Because the repulsive guidance molecule A (RGMa) was originally identified as an axon repellent in the visual system, diverse functions in the developing and adult central nervous
Jing Cai et al.
Genes & development, 32(11-12), 781-793 (2018-06-13)
Autosomal dominant polycystic kidney disease (ADPKD) is an inherited disorder caused by mutations in PKD1 or PKD2 and affects one in 500-1000 humans. Limited treatment is currently available for ADPKD. Here we identify the Hippo signaling effector YAP and its

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service